Description :
From Genome Similarity Track
Location :
Scaffold_129:24359- 25378
Sequence
1019 bases(100 bases per row)
GGGACTATGAGGACGAGCATTTATGAATAGTGACATCGATGTGGAGGTATTCATGGTGCTGACAGAGGGATAAGTTGTTGATGGCAAAGAACATTGGGTT
TATCTGCTCAAAAAGAGCCTTATGGCCTTAAACAGGCCCCACGAGTGTGGCTTATGGTGTGGAAGACCTTTTTGGAGAGAGTAGGCTACATATTATTGGG
CAGTGAGATTTGTGCTGCCGCTAAAGTCATCGATGGCTGGCTGGTGTACATTTCCATCTAGGGGGATGATCTATTTTTTTCGCTCCTAATACGACGGCGA
TACGCGACATGAAAAAGGTGTTGCTTGGTCGAAAGATCTCGGACCGATCCATTACATCCTTGGATGGGAGATCAGATGAAATCGACATGACGGAACAGCA
TTCGCAAGTCAACGAGAATTTTATGCTGAAAAGGTGCTACAACGGTTTGAAACGGACAAATGCTATGGGTGTAAAGTACCAAGCACTGAAAATTTGAAGT
TGTCAAGGTCCATGTGTCCTATGGAAAAAGAAGAGAAAGAACTGATGCAGATATCAGCACTTTGATATATTTAATACTTGGTACACTTGCATACCTCGTT
CGAGATTGCACTCAATACCTTCAAAATACATGAATTTTGCACTGGCGTGCAGCAAAAGTGGCTTTCGTTATCTGGAAGAGACGATGAAGTGGGATTATAA
GAGACACCATGTTCAAGCATACTCAGACGAAGACTTCGCAAAACAGAGTTGATGATCGTAGTTTTGTTGCTGGGTACCTTCCACAGTTTATGGAAGTACC
ATCTCGTGGTGTAGTTAGACAGAAAGAACGGTCGCATTACATACGACTGAAGCGGAGTATATGGCGCTGAGTATGATGGTGCAGGAAGTTGTACATCTTC
GACAATTACTAGAAAAGCTAAAGATGAAGCAGCAAGAAGGCTCAAAAGTATTTGTCGACAACGAGAGTACTAAGAAGTTAGCTAAAATTCCACAATTACA
AAGCCGAACGAAGCACATT