Description :
From Genome Similarity Track
Location :
scaffold_54:243505- 245796
Transcript NameFunction/comments
Plaha_PHALS_02210EF-hand domain pair
Plaha_PHALS_14849hypothetical protein

Sequence
2291 bases(100 bases per row)
ACACTGTGTTTCAACTTTGACCATCACTCTTTATACGACGCATGGATGCGGTAAACCACGCACGCGCACTAAATGGGCTACTAACGCTTTCACGGCTTGA
GCGAATGCGACACGTGTACCATACGTGGGTGAATGTAAAAGGTGTCGAAGAGGGCATGGCACTTACGCGGCGCGAATTGCAGTGCATCCTTGAGTCCTCG
GAGTTAGGTGATCAAgtaaattttctttttgataGATTCCGCTGTGTCTCTACCAGGAAGAAACATACAGATGCCCCTTGCGTCGACCTAATGACAATTT
TAATTACGATGACACTCTTGGCTCAAGGTGCGCTTACAGAAAAGGCGCGCTTTGTCTTTCAGCTTGTCGATCTGGACACGGAGGACGACATTGTGGAGGC
AGAACTTGCGCTTGTGATTAGCACATGCTGCAACGGTCTTCATCGGCTTGGAATAATAGAGAATCGTGATACGATGTCCGAATTGGACGCAATGGCAGTA
GCGTACGAAGCATTCGACTTCGTAGACCTTGAAGATGGAGATAAAATGAGCTTCGAACTGTTTTTGAAGTGGTGTGTGTTTCATCCACGACCGAAGACGC
TGTTGAACAGGATTAGCTGCTTGTTTAGGGATTGCAGTGGTTGAAAAGGCTTACAGGTCGCGCCAGAAGCACTTATAACATGTCGAGACGCTCCTATAGT
AAGATACGATATGATTTGGTCGCTTGACAAATATGCAACCTGTTCCGTGCAATATACTTAAGCAGAACGtgatcaaaaaaatattggtgAACTTTCTGCA
TTGATATTCTGCTGGGCGGATCCGGATACTTGAGATTTATCAATGCTGTCCGAGTCGCAAATTATCAGAAcacaagaaaagaaaagtttgCATTTGTGCT
TTGATAGGAAGCCTGGGGCGGTTTCTAAATGATCCAGACCGTCTTGAGATCAAACAGGATAGTTTTCAGCTCCTACAGTAAAGCGTTTATGGTGCACAGT
CAGAATGTACGTTACCATTATTGCTCGATTAAACGAAAGGATGTATGACCGTTTATAACACGCACCTTATGAATTTGCGGCCCCAGACAGCCAAAAAATT
CTGTGCTTTCGAAGGATGCAGTCAGAATGactaaataaaaaatatatatacaaATGTCGCAAATTTGTGACAGAGGCAAGACTTCTTTGCAACTTGTTCT
TGTCGCCAGCATTTTAGCGTCTAACTTATGCATACAGGGACAAAAAATTAAGATTTTTCTCCTATTCCAGCAAGGTAGTTTTATCACTAGCTACCTTATG
CCTCAATATATTTGCAATCTCTGATGATTGTGTAAAATAAGTCTTGGTGTATACGTCAGATCTCATTTTGGACGCATCGCAGAATAAGTATATCGCTCAG
GTATGGGTATCAAAAATGACCGTATGAGACGTACATTTTACACGTACAACTGTAACACGCTTCgatctttttgagcaagatgcttGCTACACATAACTTA
GCTACTATATCAGTAATGGCGAACCCACTCAGACCACTACGGAGCAAAACCTGGTCACTCATGTCCATTATCATTTCAGCGGTTCACCAAGGTGACAAcg
caacatttaatttttATTCAATTTTTCTTTGTATGAAAAATTGGTCCATTTGTAAGCTTGAAGATTGAGACCGAAGCTAGCAATGAGTAAAATTTAATGG
TTTTCCGAATTTCAACGGTAGGCTAAGGTGTTCAAGATATAATTCAGGAAGGCTGTACGACACGATAGGTAAGAATTATCAGCTTTCATGATGACGATGT
CAATATGTGTTGCCAAAGTGCTGGCGTCGTCGCTGATTCCAGCTTGGTTGTTTGGTTATATGACGGATTTGCAGTGGAAGCTGCAATTTGATGATGACCC
AACTTTGACTAAAAGTAACGGAGCCAACTCGAAACTGCTTTTCAACAGATCAATTGATGTTGTGTCGTACTGCGGACTTCCACTTTTAAATATAGACGCG
CACAAAGTGAAGACTATGAGTTTTGCGCCGTGGCAACACTAAGACGTCGTCAGCACCTGACAAATCAAAAATAATATATTGTGAGATCTTTCGTGGCTAA
AAGACTTTACAATCGCTTGATAAGATTACCAGCGTTTCCATTTTCTGAGTCAAAAATAAATGTTGGCGCACTAAATTCGCAAAAGAGTATCAAGCAATGA
TAAAGATTAGAAATGCCTGAAGCGGTAGAGCGTTCATTGCGGCTATGAATCAGTTGATGCTTACTCAATTGCGATGCGCCAGCGGATCCTA