Description :
From Genome Similarity Track
Location :
Scaffold_24:243505- 244687
Sequence
1182 bases(100 bases per row)
TCTGTCGTGGCTTGAAAGGCTAGATTCTGCCATTCCATGTATCGACGAGATCCGATCGACACATATCCTGGGATCCGGGTATCCGATCTCCAGCCAGCCA
CATCGCGATCCGTTCATTCCGATGCAAGACGAGGTCTTTGTCGCTGATGTTGGTAACCTGGAGATATCGGATCCTGCCGGGTCATCGGACCACGGTCGGC
ACCCAGCGATCTCCACGGGTGACCCACAGCTTTTCTCGATCCGTCACCTTCATTCGTAGCGGAAGCTCGATCGAATCCCCGATCGCGATCTGCATTCCCT
GATCCACACACACGTGTCGGACATTGTCGTTGTACAGCTGACGCCGTCCGCTAAGCTGGATCTTGACTTCGTCGGGGAGACAGATAGAGCCGTCCGCAAG
ATCGAGGCGAATCCCCGCCGGAACCATGAAGTCCATACCCAGGATCGCCTCTTGTCCTGATAGATCGCCAACCCAGATATCGAAGAAATACACCAGCGAT
CCCGCCAGCGTAACCTTGATCCTGGTCCTTCCTTCCGTCATGTACACGCTTTCGCCAATCCCCACACATTCCTGGCTCGGACTCGTGTCGACATAGCACC
CCACCTTACGAGCAAAGGCGGTGTCCACGATGGACACATCGGCGCCGGTGTCTAAGAGTAAGATCGACTTCTCATTGTTGATCTTGCCAGTGATCTTGGC
CTGACGGAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGACTCCCCAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTTCGCTG
ACGCGAGGCCGACTTCGATCGCGATCATGCTCCGGGATCTCGGTCGTCACTTCTCCACCAGCTGGCTTGAACCATTCCTCCGGTCTGCGTTGCTTCCAAT
AGCCCCGCGTTTCTCCAAACTGGAGATCCAAGGGCACTTCGAGACTTAAGTCCTTGGCGGCAAATTTCGCATGCAGATCACATGTATTACCGCGTAGATC
AGTCCGTCCACTTACTCGATCTACCGTGTTCTTGTTTACGAATGCATAGATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGT
CCTAGTTTAACTTCTTCTCGGCGATCGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA