Description :
From Genome Similarity Track
Location :
Scaffold_97:243492- 248791
Sequence
5299 bases(100 bases per row)
GTGTAAGCAAGTAACGGAGTAAATACCTGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTTCGACATGAGCCAAGACCTCGACCA
CGCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAAGCTCTCCACCGCCTCGCGGCGGTGTCCGGAGAAGTCGTCGTCACGTCGCTGCTGCGCTCAGCG
ACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGCTCGCCGCTGCGAATCGGCGAGTGTCAACTCCCTCGCGTATCTCCACGAATG
ACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAGAAGATCGACTTCCGCTGAATCGCTGGTTTCGAGAGATCGACATCGCCATCGCCTCGAG
GTTGATCGAGGCGCCTTCCGCGAAGGTCCATTGCCACCTCTCGCGGTTGTCTGAGAAAGCCAAGGAATGGGCTCTCGGCAAGTTGGTTGTCGATCCCAAC
GTCTTCCCCACTCTGGATACCCTCCAGGGTGACCTTCGGCTCGCGTTCGAGCCGCCGCAAGATGAATCCCGAATTCGGGCAGACTTCTTCGCCCTTCGGC
AAGGCATGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTCGCGTCGTGCATCGTGTCTAAGCCGATCGATATGGCCTCTCAGGCTCATGTATT
CGTGTTCGGTATGCGCAAAGGCATGACGCGCTACTGCCTTACAAGATCGGACCCCTCCACGCTCGAAGAGGCATTCGCCCTCGCCCTACGCGAGGACTAC
GTGGTCGCGGCGTCATACGCTCACGCGCTATCTGCTTCAGCTCGGGATTCTGCTCCCGAGCCCATGGACATCGACGCTATCGATGCGACGAGCACTCGTC
AGCGTCATGTAGCGCGTCGGAGCGGTGCTCGGAACAATCGTTCTCTCACCTGCTTCCGCTGTCGGAAGGTCGGTCATCGCGCGGCGGAGTGCCGCGCGCC
AGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGTTCTGACCAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGGGGCGCCCTACTAACTGGAATG
GAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCCTGTGCTGCATGCACACTTTCATGCCACCACCACGCCGAGCGATTCAAGATTGATCAT
TGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGTGCTCCTTGATTCAGGAGCGACCAACAACTTATTCCGCGCGTCGTGCTTGTCGGTACTC
CCGTCGGACATCACTGTCCGCAAAGGTAGAGGGGAGGTCGCTGTCAAGTTGCCTGATGGGAAATCACGCCGCGTCGCGCGGCGCGAGATTACACTTCCGT
ACACGTTCGACGGTTTCCGAAGCAACGACGACTTCCTCGACATTGAGATGAATTACGCGTTTGACTGCATCCTGGGTATGCCGTGGCTGACGCGCTATCA
ACCAGAGATTGACTGGTTGGCCCGGTCGGTCAAGCGCCGCAGTGATTATGATGTGAGCGAGGTGTCCACGCACCTCCTGGTCGCCCAGAAGGATTGGCCT
CACGTCACCGTCGTGGACCGGTCATCCACGACGCACGTTGTGCACAGAGTGAGCGATGGCCCTCTCTGCACGGCTTGCGCAGTGCTGTTAACTGACGAGA
CCCCGCGGCGACGCGGGGATAAAGACGAACTGGCGGTCGAGCAGGGGCTCCCGCGACGAACGAGATGGCGGTCGAGCAGGGGCTCCCGCGACGAACGAGA
TGGCGGTCGAGCAGGGGCTCCCGTCAATTGAGCCGGTGGTCGAGCAGTTGGCGCTCCCGCTGAACACTACCGCGGTCGAGCAGGGGCTCCCGCTAGAGGG
GGGTGACATCTCGTCCAGCGAGAGCGACTCATCATCCTCAAGTTCGCACTCGAAGCGGCGAAAGAGGAAGTCGAAGCGGCGTCGGCTGAAACCTCGCCGA
GAGCCCGTACCAAGTGCCAGCTCACCGACGGAGTCGGTCTGCGTGCTTGAATATGTGGAAGGTACCTCTGGCCGCCGACGAACACTCGAGCTTGCAAACC
CGCCTGGCGAGGCAGGGTCGATCACTCGACTTCCAGGTCTTCGCGGCCTCAAGGCCGATGAAATCGAACAGATTTGCCTGATCACCGACGCCCAATTGGC
GTCGCTCGAAGTGAATGCAGTCAGTGACAACGTCTCGCGTCCAAAGAGCGCTGAACCGAAGTCGGCCCGCGAGGAGCGCTTCGCAGCGCAGTCTTGGGAA
GCGCTACGCAAATCCGGCAATCCAGTCTACGAGTGCGCCCGCGAATATGAAGATGTATTTCCGGATAAGATCCCAGCTGAGTTGCCAGCTGACTGAGGAA
TTCGCCACGAGATCGATCTCGTGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATCAGGTCCAAGCTATCGATGACTTCTTCGA
GAGCCGCCGCAAGGCGGGTCATGTGCGTGAGAGCACATCGCCGCACTCGAGTCCGACCTTCTGTGTTAAGAAAGCCACGGGCGGATGGCGCATCGTCCAT
GCCTTCAACAAGCTGAACGACGCTACCATCCCTGCCCAGATGCCGATTCCTCGGAAGGACGTTGTGCTCGACGCAATGTCGGGTAGTGAGGTCTTCAGCG
CCATCGACTTGACCGATGGGTTCTACCAAATCCTCATGAGGCTGAGCGATATACCGCTCACAGCGGTAAGCACTCCCAGTGGTATGCTCTGGGAGTGACT
TGTTATGCCACAAGGCTTGAAGAATGCTCCCACCACGTTCAATCGCATGATACCCCATGTGCTGCGCCCGCTCCGCGATTTCGCACCGAGTTATTTCGAT
GACATCTTCGTACACAGTCGCGCTGAGGGAGGCCTCAGCGCGCTCGAAGTCCACTTGAAGCATCTGAGGCAAGTCTTCCAAGTGATGCGCGAAAACAAGC
TGTATGCCAACTTGAAGAAGTGTATATTCGACGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAACGGCGTCCGCGCCGACCCCGAGAAAGG
GTCGTCGATATGTGCGTGGCCTACTCCACAGAACCCCACTGAACTGCGTCAGTGGCTGGGTCTCGCAAATTATCTCCACAAGTACACGAAGAATTACGCC
GGATTGATCCAGCCGCTCTCTTTGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGGACATCAAGCCGCCTTCGACTCGGTGAAGAAGAGTCTCG
CCGAGGCCCCAATCCTCGCGCTCCCGGATGACTCGAAGCCTTTTCACGTCGTCTGCGACGCGAGTGATTTTGCCATCGGCTGTGCGCTGATGCAATTCGA
TGAAGAAGGTCGAGAGCGTGTCGTAAGCTACCAGTCCAGGCAGATGAATCCGGCGGAGCGCAACTACCCTGTTCACGACAAGGAGCTCCTTGCGATGTGC
TACGCTCTGATCAAGTTCAGAGTGTACTTGTTGGGTGAGGATACCTTCGCGGTGTACACCGACCATGCATCGCTGAGGACAGCGATGAAGAGTCCTCATC
TCTCCCAGCGGATGGCCCGCTGCCTTTCGTTCTTCTTTGAGTACAACTTCGTTGTCCACTACAAGCCCGGCAAGAACAACATTCTCGCCGACGCTTTGTC
TCGGCGTCCCGACTACGACCCACGCGGTGCATTGGGTCGACAAGCTTCGCTGGATGAAGACGATGTAGACGAGTGTGCCACGTGCGAGGCGTCAGGCGTC
AACCTGACGAGCTTCTTCCCGGTAATGCCACTTCGCGACGAGATCCGAGCTGCTTACGACCATGACTCGATGTGCTCCAGTATCCTGGAGCATCTCCGCT
CTCCCAGCGCCGATACACTGGGAGCCCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATCGTCTCGAGGACGAGCTGCTGACGTACAGCATGGACAA
CTTCGATTTCCCACGTATCGTTGTTTCTAGCGACCCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATGCCTCGCTGGGTGCTCATCTCGGTCGC
GAGAAGACATTTGCCGCTGTGTCACGCGACTTTTATTGGCCCCACCTGTACAAATGGGTACGCAAGTGGGTGCGCACCTGCGAGATCTGCCATCGCGTGA
AACCTGCCTCGTCTTCGCAAGCCCCCCTGCGTCCTCTACCGGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATGAATTCATCTTCGGGCTCCCACCCGAT
GCTAAAGGACGCTCAGGTGTCTTGGTGTTCGTAGACCGCTTCAGCAAGATGGTCCACCTGATTCCGGTGTCGGATTCGATCACCGCGGCAGATACCGCGG
TGCACTTCATCGATGCGGTCTTCCGCCATCATGGTCTTTCTGAATCCATCGTCTCCGACCGCGACCCGCGCTTCACGTCGGCCTTCGGGTCGAAGCTCTT
CGAGATACTGGGCTCGAAGCTGTTGATGTCGACAGCAGCCCATCAGGAAACGGACGGCCAGACGGAGCGCGTAAATCGCGTCCTCGAAGACGTCCTTCGA
AGCTACGCGACATCGTTCTCCAGCTGGAGCTCGTTTCTGCCTCTGGCCGAGTTCGCGCTGAACAACGCGCGACACGCGTCGACTGGGCTGACGCCCTTCT
TCATTAACAACGCGCGACACCCGCGTGTCCCTGCTCTTCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCCACAAGAAGCTGCCGACAAGCCGTCTA
CTCCAGCTCCGATGTCTCCGGCGGCAACACCGGTACTAGGTCAACCGGTACACACACCGGTTGCTAATGATATCTCGGGTGTATCCCCAGTCCCCACATC
GGTCAACGCAGTGACACTTTCCGCATTGAGCCCACTTGCGCCGGCTAACTACGCGCCGAAGCATGCGGCGCGACCAATCGACTCCGCAGTCGTCTCCGAC
TTCGTACTACAGCGCCAAGCGGTCGCCCGCTATGTTCGTGACGCACTGCAGGACGCAGTGGACAAGCAGAAGGAGAACGCTGATAAGACTGGCCGCAAGA
ACACAGCCACGTTTACGACAGGCGAATGAGTGCTCCTGTCGACTGAAGGTATCAGAAACGCTGCGGTTACCAACCTCGGCGCGAACAAACTCGCGCCGCG
CTTTATTGAGCCGTTTACGGTGATCAAGACCATTGGTGACGCTTACACTCTGGATATTCCTTCGACACTACGGCTACATCCGACGTTCTACGTCGGACG