Description :
From Genome Similarity Track
Location :
Scaffold_47:24347- 28412
Sequence
4065 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGCCATCCTTTGCGAGAGGTGTGGGCTGTTTACGGACGTGCGTAATGACGCATGGTCCGTATAGACTACAAACGGCCTATCTC
CAAGGAGATAGACACGAAACTTCGCTAGTGCATACTTTATGGCAAGGAGTTCCGTGACATGCACTGGATAATTACACTCAGCTGCTTGCAGCTGACGCGA
TTGATAACAGACGTCATGCTCTGCGCCGTCTGCATCGTACTGCATTAACGCGCAGCCGATTGCAAAATCGCTGACCACATGGAATGGTCTGTCTTGGTCT
GCAATCGCCAAGATGGGCGATTGCATCAAACTCTGCTCGATACTCTCAAAGGAACGCTGACAATCAGCGTTCCATGACCACTTCTCGTTCTTTTTCAAGT
GACGAGAGAGATGAACGGTCATTTCAGCGTAGTTCCTCGAGTAATTGTGTAATCAACCCGCTAGACCAAGGAACTTTCTAAGTTCTCTAACGTCGACTGG
CACAGGCCAGTCGGTAATCGCCTTGATCTTTTCAAGATCAGGACGTACGCCGTGTTTACCCACGATGCACTCAAGAAGTGGTATTTCGCTAGCAGCGAAT
ATTCAAATCTTGAGGTTGACGTACAGCTTATGCTTGCGCATAAGTTTAAGAACCTGACGAACGTGAGTTCTATGAACCTCTACGTCCGTCTTCCCGCTCA
TAGACCGGCTATGGACGAATAAATCGTCAAAGTAACTCGGTGCGAAGTCTCGCACCGGTCTCAACAGATGTGTTACAGATCTGTTGAAGGTGGCATGGGC
GTTACTAAGCCCTTGTGGCATTACTAGCCACTCCCAGAGCATGCCGCTCGGGGTGCTTACTGCCGTGTACGGGATGTCCCGTTCACGCATTAGGATCTAT
AGAAGCCATCTATCAGATCCATGGATGAATAGGTGGTACTCTTTGGGAACCATCAAAGAATGAGTCCTTCATGGTTATCCCAGTCTAACCCGTAACACTT
GCAGCATACAACTTGTTAAATGCGTGCAATATCCGCCATCCTCCTGTGGCCTTGCGCACACAGAAGGTCGGAGATCTGCAAGGGGGAGTTGACTCCCTCA
CATGACCCGCATCTAAGTGATCAGCAAAGAACTTGTCGATCACAAGTACTTTTTCACGAGGCAGTGGCCACTGCTTCATGGCACAGTACTTCGAGCCCGG
TTTGAGCTCGATTTCATGTCGAGTGCCTTTATCCTTAGGCGATTCGCATGGTACGGATTCAGGGAACACGTCCTTAAATTTGATCAAATCCTTATATATA
GGTTACGCCTGAAGCGACTCCCAAGATTGAGACGTGTATCGCTCAATTCGAGTCTTCTCATCGAGGACACTTTCGTCCATCGATGAGCTGTTGAAAACCC
TTTCTTTCCCGGCAAATACTACTGCCGACCGAATTTCAGTCACGTATTCCTCCTCCGTGACGAGTACACAGATCTGCTTGACATAGCCATTACGCAGATC
TCGCAAGAACCGTTTCGGTTCTAGCGTTGGCAATTGAGTGATCTCCGAAGTCAACTTCGGAGGCGCGATCAGATCAAGTGTATAAGCGCCTACACTTGAC
CCGTCACTAACCAAGACAAACAATGTCTCGGTTTCTTCCTGGAAACCCTTTTCCACAGGCTGCTGGGGTCTTATTCCCTCAGGCTGATGAGGTCTTGTTA
CCTCACCAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
ATATGATGAACAAGTGGCAGGCGTCTTCACGGTTCGATGCTGCCAGATGATCTTTGGCTCGTACCTTCTGAGCCGGGGTAACCCTAGGATGGTATCAAAT
TTGTCATCCAAATCAAGTACGATGAAATCATCATTGTACTGCAAATCTGCTAACGTGTAGTGAAATCTCACTACACGTTTCATCACTGCTATAGATACGC
CTGTTGCGAGACGCACCGTCAGACTCGTAGGAGGAGTAACGCGTTCAACGAACTTGATCCTGCGATACTCTAGCAACTGGCGACGGAAAAAGTTGTTCGA
CGCCCCACAGTCAACTAAGGCACGAAGTGACAAATCTGTTGTCACTTCTAAATTCAATTTTGTGAGGGGTATCTCATCACCAAGTGCAGAGATACACAAG
GATTGTGAGTCTGGAGCAACTTTCATCAATAGGTTTGCAAATTCTATTGAGGTTGCTGGATCAGTAGGGAGCTCCGCCCCTACTGACCCCGACGGTTTTT
TGACGGTACGCTACGCTGTTGTGACTTCGCAACAGCGTCGGACCCGCGTCCGTTGATCTTCTTGGCAGACGGTCGATCGCTTCGCTCAGTGTTGCAAGAC
ACTGGGCGTGAAGCACTACACTCGTAGGCGTAGTGTCCTAACTTCTGACAGTGATTGCACTTTTGCAATTGCTTCCTGCTTGAAAAGCGAGGTCTCTCGC
TCTCGACACTGCAAATGTCCATTGGTTCTGGACCTGCCGCCTCTGCTCGTCTCGAAGGACGATAGGGGGTCAAGCCAGTGTGAGCCTGTCTCACACTAAA
GTCCTCTTGCACCGCAGTTGTAATTAGCAGTTCTCAAGCGACTTCAACTCGATGCAGAATAGGTGGTTCCTCACGGGACGATCTATTAAGCCCTGTAAGA
ATATCGTGATCAACACGAATTCGCTTACAGGGTTCGCTGCCATGCAACTTGCAAGGTAACGAACGTGCTATGCATGAGCGTGAACGTCACGCTTACCTTG
TTTATCTTCAGGAGCTCTGAAAGAGTCCTGGACTCAGCCTTGGCGGCTCCAACGTTTGGCTGAGC