Description :
From Genome Similarity Track
Location :
Scaffold_105:243442- 250104
Transcript NameFunction/comments
Physo_141935predicted protein
Physo_141936hypothetical protein
Physo_141937protein phosphatase 2C, putative
Physo_141938hypothetical protein

Sequence
6662 bases(100 bases per row)
CAAGCTGCTTCGACAGCTCAGGGACGCGATCATGGAACGGACCGTACGGCACAAATCTCAGCAAAGTTCGCGACCGCTTCTCCTGCTCCTTCCGCAGCGC
CTGAAGGTACAGTTGCTGTGCGTTCGAGCGTACAGCATTCGCTCGATACGCCCCCTTTGCCAAGTACGAGAACGGCAGCACTCCCACAGAGTTCCGCGGA
TACGGCAACCCCAGCAACGCGCTGATCAACGGAGCAACATCAGCCTGCATCACGTCCTTGCGCAGCAACTTGTTGAGCGCTCCCCACTCGTCCACCGCCG
CTTGTTCCTGCTCCTCCTGGGCTTGAAGCTGCGCTTGGACCTGCGCGCGCGACTGCGTGGGCAGATCAATCTCAAACTCCTCACTCTTCTGCACTTCGGT
AGGTCCCTGCACGCCCGCTCCCCACACAACCAGCGGCGTGCGGGTATTGGCGGGGTCTCCGTCTCCATGAGCTCCTTTCAGCCCCATTCCATGGTCCGCC
GTGAACACGTAGGCCGTGCGTCCGTCATAACCGTAGAACTCCTCCACCATCCGATACGTCTTCTCCACCAGCTCGTCCACCAGCGCGATATTGTTCAAAT
AGTCCTTGGAATTGGGTCGATGGGCGTGTCCATTGGAGTCGATGCCCAGATAATGGCAGAACACCACGACCCCTTCCTCATTTAACTTCTCAGACAGCTT
CGAGTCCTCTTTAGCCACGTCCAGCAGCCTCTGCAGGTGGCGGAACACCCACACGTCCAACTCGGACGAGTCTCCCTTGGCGAAGTCCTCCTCCTCGTGC
GAGTAGTGCTCTTCAAGTGCTTGTGACACATGGCGAGCAAACATCGGCACGATGTCCGGGCTGCCGAACAGGAAGGCGCTGCTGCTCTGGTTGAAGACCG
AGTCGAAGTCCACGGGGTTGTCAGCCCAGCCCTTGGTCACGGCGCTCACGTCCTCGTACATGCCGGCGAAGAGCGCCACGTGGCCCGGACGGCTCTCGGT
GGGCACGCGCGTGTGCGAGACGCCGTAGCTGCCGCGAGTCTCGATGATGTTGCGTAGGAAGGAGGCGCGTGGTCCCGCGCGCGCGTCGGCGCGTGCCGTC
TTGGCCTCGAAAAACTTGTCTGCTCTACAACCGTCGGCTACGAAGACGATCACGCGCTTGGCCGGCGGCGCGTCCGTGTAGGCCACGCTCTCGACGTGCG
GTACCACGGGGGACGTGAAGTAGATGTCGAAGATGCTCAGCACGTACAGCGCGTGGAAGGTCACGCCCAGCACCAGCAGCCGCGCCAGGCCGGAGCCCAC
TTTGCGCAACGTCATGACGCTCTTGGAGATATGAAGTGAAGTGAGGGAGAAGATACACTTGTCGTTTGTATGTGGAAAAGTGCTATTGTAACTGTAGATG
CTCTACAACTGCGTGATATGTTAATTTGAGTTATTTAGAGCGGTTACATGTGTATGGTATAGTGACGAATACAAAGGGCAAGTGACCTTTTTTTCGTTAT
TGTTGCAATATGCCGCAGATGGGCGGGAGCATCCGCGAGGAGGTGGAGGTGGCGCTGCACGAGCACCGCTTCCTCGTGACCAAGCTGCTGGAGTCCCTCA
ACACAGCCTCACTGTACGTGCACCCTATCTCTAATCCCACCGCTGCGTGGCTCCAATCCGAAGTATTTCTCATGTAATCTAGCGCCTTATAACATGTGCT
CTTCAACTGTATGCTATGCAGGCCGCCGTCCACGATCACCGCCACGAGGCTGCGCACCGTGAACGAGACGTTCAACAAGGTGCTGGAAAAGGACCGGGAC
CTGCTGGCGGCCGTCAAGAAGCGTGCGTTGGGCTAAAGGCCTTGGTATTGACGAGATAGGAGTGCTCTATTGACACTGAGAGCTGTTGACACTTGACGCA
GTGGCCAGGCACCAGGTGGCGCAGAAGGAGCTGCTGCGCGTGGAGGCGGAGATCGAGAGCAAGAAGCAGAAGGTCGTGCAGTATGCAGCGCAGCTGCGGC
GCTCCCAGGAGGACATCGCCAATGTGCTGAGGAAACACCGCGTCGTGCTGCAGAACGCCAAGCAGAAGTCCAAAGGTAGAGCTTGGCTTAGCTTGACTTC
AAGGAGGAGATGCGTACTGATCTATGTCTGTGTGGCGTTGTAGTGGTTCTCGACCCGCGCGACATTGTGGCGTACGCGCACCGCATTGCCGGCACGACGT
CGGCACCCAAGGAGTGGCAGCCCGGAGTACGTGGGCTGATCTCCCCAATAGCGTCCTTTTGTGGAGGTCACGCGCGACTTTGCTGACACTTTATTTCTCT
GTGTTTTCTGGTTGTGGTCAGTTCCCCATGTTTGGGTTCATGCCGCCGGCGCCGCAGGAGCACATGATGCGTGCGGGTGTGCTCAGTCGCGGCATCGTGG
CGGAGATCGTGACCCAAGGGCCGGAGAAGTACACGTCCACAGCGGCGCGTGTCAAGCAGGACGGCGACGGTGGCGAGGCCATCGAGAAGCTCAACATCCC
CATTGGCTTGGGCGCCAGCGACGCGCAGATCCGCAAGCAGATGCCGCCAGGATGGAAGCCCGGCGACCCCGTGGACCTGCCGCTAGACGCGCTGCTGCAC
TACATGGGCCGGAGTTTCTTCACGGAGCACGGCATCACGCTGCCCGAGTCGTGGAAGACTGGAGACCCGCTGCCGCCCGACGTGATGGAGATCCTGCGCA
AGAAGTTCAAGCTGCCGGAGAAGCGTGCACCACTGTACGACGACGAGGTCGTGGACGACGTGGAAGGTCTCCGCAAGAAGCGCAAGCTGGAAGAAGGCGA
CAAGGCCGAGGACGGTGCCGCCGACAGCGACAGCTCGAGCGACTCGAGCGACAGCGACGAGGAGGCCCCCAACACCATCTCGCTCAGCCTCTCGTCGTCC
GAAGACGAGAGCGACGACGACAGCGACTAGAGCCCTTGCTAAAATGGCTACACTTGCACGTCATATGGTCATATGGCTACATGTATATCGCCGATCTTTT
GGATCTTTTGCGAAATACCGGACTCGCACGCGTAAACATATCGAGAGCCTGAAATTAGATCCAAGAGCGGTGGGGGTATCTCGTGTGTAGTGTTCTGCAA
GTAGAGCTCTACTGCAGCACTGTGGGTTTATCCTCAGCTCAGCTCAGCTCAGTCTAAAGGCGTCAAGCCTCGCTTTTCTTAGCTGCACGTCGCGCCTGCC
GACTTCTGGTCACTGGCCCCTCCCACAGTTCACTACGTGCACGCCGGTTCACCTTTGATCGCTTTAGGCCGCGCCCGTCGGCTATAATTACTGCGACTAA
CTCACTCGCCTCCAGCTCTGGCCCGTTACTCCAGACTCCAGGCTCAGTCTCGATTCACTCCGGCATTTGCAGCGTCCCAGTCGCAGTCGCCTGCCTCCTT
CCTCCTTCACCTCTAGCTCGAGCTTTTCGACCAACACCATGGCCACCCGAGCAGTGCAGAAGACGGGCTCGACCGTGAAGCTCCGCCAGCAGGAGGCCAC
GGCCGCCAATGTGGCGTCGCCCAAGGGCATCTCCATCAAGACGCCGGGCAAGATCCCGGCCGCCGCGAAGGGAGGTGACCACTCGCTCGGGCTGCAGCGC
CGTCGGCTGTCCGTGGTGAGCGACAACAAGCTCGTGGACGGCATGGCTGCAGCCACGATCGAGGAAGTGGACAGCAGCGCCCAGGCGCTGGCGGACGGGA
GCTGCGCCGTCGTGGCCTTCGCTGGACTCTCCAAGAAGGGCTACGCGCCGTACAACCCGCGCAAGAAGAACCAGGACGCCATGGTCATCAAGTACGACGG
CAACACGCAGTCGCTGCTTTTGTGTGTGTTCGACGGCCACGGAGAGGCCGGTGACGGCGTCTCTGGGGCCATTCGCGACCGGTTTGCGACTGAGCTCTTC
GCACACGCCAAGTTCGAGCGGTCCGGAAATATTCAACAGGACGCTGAGAGCTTGCGGACGGCCATTACGGACACGCTGCGGTCTGTGGAGCAGACTGTGC
TACGAGACCCCAACATCGACACGGAGTTCAGCGGAACGACTGCGGTTGTGACTGTGGTGCGCGATAACCTCGTCGTGGTCGGCAACGTCGGTGACTCGCG
GATCACGCGTGGATTCGTGAAGCTTCTGGGTCCGTCGGGTCCCGAGGCGCTCGGCTGCCAGGAGCTGTCTATTGACCACAAGCCCGACCGACCGGACGAG
AAGGCTCGCATCATTGCCAGCGGTGGCCGCGTGTTCGCTGTCGAGTACGACGACGGCATTGACGGCCCTCCCCGTGTCTGGCTCGGCCACATGGATGTCC
CCGGTCTCGCCATGTCCCGCTCGCTGGGTGATGCGGTCGCTCACACTGCTGGAGTTCTGTCGGAGCCGGAGTTTACTACGCGATATCTCGACGAGAACGA
CCGATGCCTCATTGTGGCGACGGATGGTCTGTGGGAATTCATGTCGAACGAGGAGTGCATGGAGATGGCCATGGGGCAGCAGGACCCCAAGGTGGCAGTC
GATCTTCTGATCATGGAGGCAAACCGCCGCTGGATGAAGGAGGAGCAGGTCATCGACGACACCACGATCATCGTGGCTTACATCGACACTGTCGGCCTGA
AAGATAGCGCCAAGGCCGCCTCATAAACGACGAGGGCGAATTTATAAGCACTTCAGCAAGTTGCAAAACCCCAAGATCTCTACAGTATCATCGCCCGCAC
ACATTTTGCTGCCTTTACTACACACCTCTAGACAACGATTAGCTTGTCCGGATTAAATAATATAGCCACGAGCTCTCATGCATACTACACAGCTTCGTTT
TATTGTACTATCTGATAGGAATCATGCACGTTGAAGTTGTCACCTGGAGTGTTGAAGCGATGACGTAACTTTTCGACAGTCGTTGGGCTTATCAATTGAC
GAGACATTCGTAACGCAACACAAGTCAAGCCAAGAGAACACTGAGCTCATGGGGGGAAAGCGAATTGGTATCATTGTGCTCTTTACATGGAAACGGAAAC
GCTGCCCTCTGCGCAGGAGCTAATTAGCTCGCACGATGATGCTCTGCTTCTTCAGCAGAAACACATTTTCCAACCCGTCGCCGTCGACTTTACTCCCATA
CGCTGGACTTAAAAGTCGTCGTCGTCATCGTCGTCGTCCTCATCACTGAAGTACGTTCGCCGCTTCATCTGCACCAACACAACGAATAAAAACACCTCGT
AAGATTCTACGGCAAAAATCTCGATCTTCCTGGCCATCATACCGTGACTTTGGTGCGCTGCTTCTCCTCCGAGACGCCCACTTGGTTCAGCAGGTCGATG
AGCTTGTCCTCGTCGATCTTGGCCGTCAGCTGACCGCGCTGGGCCATCTGGATCACCATGTCCTCGATGGCGCGAGCCTTCTCGGGCTTCACGATCGCTA
TTCTAGCCACTGAACAGCAACAAAACCTCATCGTCAGCCACCGTCACACCCCCAGCAGCTAGTAGTTAGCTTCTTTCAGTACGTACAGCGCTCGCGAGCG
TCGGGCAGCATGACCTGCTGCATCATGGACTGGCGCATCTGCTCCTGCTCCCTAGAGACCATCAGCAGCACAGCAAAGACTCAGCTCCAGACCCTCCACA
GGCGTCGATACCCCCGCTGACACTCACTGCTGCTTCATCTGCTGCTGCTGCATCTGCTCCATGGACATCTGCGACTGCGCCGCCGTCTTCTCCTAAAGTG
GGTAAGGAATGATACACGGCAATGAAGGCTTTGGTTAGGGCGAACCACTGCACGGTTGGGAGCGAGAGCGGGCTCAATCGAGAGCGGAGAGAGTGAGGAA
AGTGAAGGTGGGGGTTGTGGCATGGGAACGAGGCTCTACTGGGCCGCAGGGGCGGTAGCTACGTACGCTCATGGTGACCGCTTTGACTCGTTTGGTCTTG
TCGTGTGCTTGTTTGTGAATGGATCGATGGACTAGGTGTGCCACATAATGTAGCCATTTTTCGCTCGGGAATATTTATACTGCATTTGGCATTTTTTTTC
TTGAGAAAACGTGAAATTGTCCAATTTGATTCAAGCAAGGTTTGACTCGGTAGAGAGATATTCGGCAAATTACACTCGTAGTGTATCCCATCACGGAATA
CATGTATTGTGCTTTTCAGTTGTTTTGGCAAATCGGACGTGTAAAACAGCTACCTACTAAGACGGGGCTAGGTTATCGGAGCAGATTAGCAGGCCCCTCG
TAGGGAATTAGGACCAAGAATTGCTAGTCCGATGGAAGCACTTGCGTAGGTCCTACAAACAGCCGAAAGCCCGAATGTCGTCCATTCTCACGGCATTCGG
GGTTTGAGGTCTTACCAAGGACTCCTGTCAAGTCTTGTGGCAGGACTTTCATACGAGCTGACTCTAATACGGTGTATGTCAGACGCAGAATAAACCTAGG
TAAGCACGATGCGGTCGATACATTAAACAACCAAGTCTTCTCCCTTCGTCTTCGTGGGTTCCAGCACTGATTGCTTCCCCAAACAAAGCTTGCTTGGCTT
GGACGTCCATTGAACGGAGAGCCTCCGGGAGACCGCTCATCGGACTCGTCCGAGATTTGCATCTCAGATTTAGAGACCCCCAACCTCAGATTAACTGACC
TCCAAAGTCCTACGTAGGACTCGGCAAAATGACCGAAAGGCACAATACCCCATTTCCGCAGC