Description :
From Genome Similarity Track
Location :
contig_9:243433- 245098
Transcript NameFunction/comments
g2244.t1hypothetical protein

Sequence
1665 bases(100 bases per row)
AAGCTTCTTTGGAAGGTATCCTGCAGGACATCGATGACCGGACGAAGCTTCCAGGCTCGGTCGGTGACCGCACGATCGTCACCATTGCTGCTGAAGTGAA
GATTGCGCGAGATGTGGTCGAATCGATCTCGTTTCATGAAGTTGCCAAAGCCTCCGCGTGGGATAGCGCCTTCGTCCGTATTCTTCCAGTGGTGTGCGAA
CTTTTCTCGGTTGGGTGCAATGGTCCTCGCAATCAGCAAACCAATGAAGCAGCACAACTCTCTGCCTGAGATTTTCAGGGTCTTTTGTAGCTTCGTCTTG
ATTTGCTCAGGGGCTTGTACCTGGAAGTCCGGTCGCTTGAGCTTGCGCGCTTGCTGCTTGGCGTGTTGGGCTTCCACACGAGCGTCCAGGTTTTCCGTAA
AGTAGGTGTCACTCTCTCTCCCGATCTTTGCCAACAGTTGCGGCGTCACGAACCGCAGGAACGCACCGAGGGGAGTAGATGCGGCCTGCAGCGCACTAGC
CGTGGGACCGTTAGGGCCGTCATAAATACCCGGATAGTCTTTGCCGAGCCATTCATCTGGTCGCACTTCATACGGTTCGTCCATGTACGGCCATGGTGTC
TGAATTCGAGGCACTGTCCAGCCATTCACAGCCATGTCATCTAAGACTTGTTTGCGTATTGTGCCGCTGGCCACAGCATCTACACCTCCCACAGCTGTGA
GCAGCTGCGGGTCAAAGTGCAGGTCTGGCGCATTGTGAGCGTCAGCATCCAGTGTAGCCCAGTCCAAGTCATCGTCGTCGCTATAGATTGAATCTCCTTC
GCCATCACCGTCCGAATCAAGCGCTGTGTAGTCTGCCAAATTGTCGCCTGGAGTGGTGATGTTGGGGTCGTTTGTGAGCGTGCCTGATACAACCAGTATA
TACAAGATTAGAGTTATAACATGTATCCATATCGTGTATGTATGCATGCCGCACTAACCTCCGACTTGACTGTCACCCTCTTTGGTTTCTTCTTCCTCGT
TGTGTGAACTCCTTACGACACCAGTCTCGTCATCATTAGACCCACGTTCTGAGTCCTCGTAGTTGCTGTCCGAGTCTGCCAAGTCGAAGAGGTTGCTGAG
ATTACGCCGTGATGACATATCTAGGAAATCCAATCCATCGTTAGTCGTTACTGCTCAATACAAAGCTGCATCGCGTAATGCGTACCATTGGTGTCGTTGT
TAGCGTTCAAATCCTCCTGACGTGTGCTTGTGCTGCTTGAATCCTCGTTCATCACGTGGGGCGAAGTGGCAATGGACTGTGGTTTGAGACCGGAGACGCG
GGAGAGTCTGCAGCTAATTTCAAGAACGTTAGCATCGCACCAGGTGACATGAGTCTATACAGCAGCATACCTGCAGGTGGCGTACGCTCCAGCGGTGCGC
GGCTTTGGTTTGATCTAGATCTTTGGAATGATCTGTACGATACACGTTAATGTCAAACAACTAGCGTGTATAATACCGGCAAGTCATCACATCCGTACCA
GTCCGTTCTGGCGGGCTTTCAAGGCGGCTGTAGCGACGTCCGGGCCCGCTGCGTCCCCTTCCTTTTGCTGACGATCTCGTTCCGCTAAAAGCGTACAGCT
CGTCAGTCTCAGTGGTGGAAAGTACGCTTGAATCTCATCTTACCGATATCCACGCGATCCAAGTA