Description :
From Genome Similarity Track
Location :
Scaffold_471:2434- 3935
Transcript NameFunction/comments
Aphin_H310_15150Hypothetical protein
Aphin_H310_15151Hypothetical protein

Sequence
1501 bases(100 bases per row)
GGCCACATTCATTAGGTCGAGCTGCATTATGGGTGCATATTCTGCATGCGCTTGCGCGCCACGAAAACGCCGACAATGGTCAAGACAACCGTCGCGACCC
CCGTGGCAGCTCCGACGACGACCCACGTCATCATGTTGGCGCCGGCAAAGGTCAGACTGCCACCGCCGTCCACTGTTACATTCGCGGCAGGGCCAGCCGA
CGCTCCTTGGACTCGAATCGGAAAAACATTCAAGCCACAGTTGAGCCCGTCATCCATCTTGAGCCACATGTACCCGCTGAGGCCCCAGTCGACGTCGTAC
GAATTCTTGAGAATCCAGTAGTTGCCGTCAGCTGAGCTTCCGTAGCCCACAAGCAAGAGGGCATGGTCAATCTGGTCGGCGCTCGTGATCGAACCACACA
CGTATAGGCCAGCCTTGTACTGTTTGAACGAGCCTTTCGCATTCACTGCGACAGCCAACGGTCCTTGCTGCAGCGCGCGCTTGAGGAGGACGATCGGGTC
CTTGGTGTCGGCACAAGACGACGCGTCTAGAGCAGGCGCCCAGCCTGAGATGTGCGCCGCCGCGTTGGCGGCCGGACGTGTAGTCGAGCACGTATTGAGG
GGGTTGACAGAGCTGTTCGTGCTGTTGGTCTTGATGGTCGAAGTGGGCGACCCAGGTTGGACTGGGCCGCCGGTCGACGACGCGATGCCTGCATCCGAGT
ACGGCCAGTCGATGCGGGTCGCCAAGTTTTTGATCTTGTTGGCGGCGTCGCTTAGTGCGATGTGCGTCATGCCGCCCGAGCACTACCGATGGACTTGAGG
AAGGGCACACGACGACAAGAGTACACGCTTACCCCGTTGTTCTTCGAGTCCCACTTCATGGTTGGCTCCAGCCAAGTTGGTATGTTGCCGCTCTTGGCAA
AGCAGTACGTGTATGTGCGGACTTCGGCGGTCGTGCTGCACGACAAGAGCTGTTGCGACGACAGTGACACGGGGACATTCTTGGTCGTGTAGGATACCGC
AGTCTCGATGAGATCCGTCGCGGCAAACGCCCAGCACGACCCACACAGCTTCTGACTCTTGACTTCAGAGCATACCGATCGCTTCTCGGGGTTGTTTTCG
GTGCACCAGTTCAACGTGGCGGGAAGCGGGGCGCCACCAACAGCTGTTGACACGGCCGTGGACGCTTGGAGGCGGCGATCCACATCTTTGCCCTGCATGT
TGACCAATACCGCGTCCATGGGGTTGCCCAGCGCAGAGGCGTCTTCGTACAAGTGTCGCGCGTTCAAACCGAGCTTTACTGTCATGTCATGGTTCAAGGC
GTTCGCATGTGTGTACACGGCTATGCAGCGCACAACGTGATCTTAGGCAAGATGAAGCCCCGTACCTTCGATGTACTGGATGTGAGTCTGCAGGTTGCGC
TTCGCCGTAGCGTAGTCGTCGCCGTGGTGGTACGTAATGAGCATGTCGTATAACATCCGTTGATCGTTGACGAGTTCGTTCTGCTTGCCCATCCACAGAC
A