Description :
From Genome Similarity Track
Location :
Scaffold_299:2434- 3857
Transcript NameFunction/comments
g16379.t1hypothetical protein

Sequence
1423 bases(100 bases per row)
GATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTGGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTG
CATACTTCATGGCAAGGAGTTCCTTGTCATATACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTC
GTGATTGTGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGAAATGGACGATCTTGGTCGGCCACCGCCAAGATCGGCGCC
TCAGTCAAGCCCAGCTTGACTGCTTCAAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGTGACAGCGGGCGAATCT
TGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCAC
TCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTTCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCTGGTTCGCG
TAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATTCGATTTCCCATTCACAGCCCGGCTGTGAATGAACA
CGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTTGCTGGGGCGTTCTTCAGCCCCTGCGGCAT
CACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTTACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCC
AGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGT
ACGCATGAACGATGCGCCACCCGCCTTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACG
ACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGC
TGAACACCCTTATCCTGCGGTAACTCAGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGT
CCCATCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCAT
CCTCTTGACGTCCGAGAGGATGC