Description :
From Genome Similarity Track
Location :
Scaffold_36:243399- 246101
Sequence
2702 bases(100 bases per row)
GTACCGCTTAATATGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAA
GGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCCCCAACCTCAA
AGATACTTAAGTTTCCTCTTCCTTGTTTGCCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTT
GATATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGTCTTACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATA
GAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACCCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGGGTTGT
TGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTAGTGCTGCCGCGCACACACTGCGCCGAGTGTCCTCGAGCACTCGATTGACGCGCTC
TGTCTGGCCGTATGTCTGCGGATGGTCCGCAGTGGACATCTGCAGACGCGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCCGTGAACCGCGGG
TCTCGGTCCGAGACAATCTTCTCTGGGAGATCGTGATAGCGGAAGACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTAACAGTGACGGGAATCG
GAGCAAGATGGTACATCTGACACGCGAACACCAAAATTCCGGTGTTGCCGTGCCCGTCGGCGGGAAGGCCAAAGATGAAGTCAAGACTCATCGACTTTCA
ACAGTCAGCCGGTAAGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTACCGGGCGACC
CACTTGTACATGTGGATCCACCAGAAGGCCTGAGAGACCGACAGAAAGGTCTTCTCGCGACCCAAGTGGCCGCTGGAGGGCGCGTCGTGCGCCTCCGCGA
GGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGCCATCCTTCAACTCATATCG
GTGGAGCCGTGAGCGCTGTCGCGACGAGAGACAGTCGGACTTCGCGCTCGTTCCTGCCATAAGGAACTGGACGATAGGCGCGACAGCCTCATCGTCCCGA
TACGCCATGCGTTCCGATCATATAGATCCGTTGTCACCCGTGTGATGTGGGTCAGCTCATAGTCAGGACGACGAGAGAGGGCGTCCGCAAGCACGTTGAG
CTTGCCTGACTTGTATTCGACGCGGAAGTTGTACTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGATGCGAGTTAGTCGCCGTCCTC
AAGGATGCGTGGTCTGTGTAGATCACGAAGGGCCTCGAGCCCAGAAGGTGAACACAAAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGT
GGACAGGGTAGTTCCGCTCGGCGGATTTGACCTGCCTGGACTGGAACGAGATGACTCGTTCATGCCCAGCCTTGTCGGCCTGCAGCAATGCACACCCGAT
GGCATAATCGGAGGCATCACAGACGACGCTAAACGGCTTCGTTTCGTCCGGCAGGGCCAGGACAGGGGGCTCTTGGAGACTGGCCTTGATGCTGTCAAAA
GCATCCTGGTGCTCTTGGTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGCCCGACAAGGGCTTAGCAAAGCCCGCATACCCCGCGCTGTGCTTGTGAA
GGTAGTTGGCCAAGGCCCAACCACTTTCGAAGATCCTTTTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGC
CCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGATGCGAACACGCACTTGTCGATGTTGGCGTATAGCTTGTTCGCTCGCATTACGTCCAA
CACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTA
CGCAAAGGGCGGAACAGTTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTG
GAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCCCGCATTAGGATCTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCAT
GCTGTTTAAGAACACATCCTTTCGTGGGATCGGTGTTTGGACCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTC
GGCTTACGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGACTACCGCACCAAGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCACCGATGACCTTGC
ACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCATGCCGTACGCCTCGATCCGGTGGGAGCTGGGC
GG