Description :
From Genome Similarity Track
Location :
Scaffold_7:243353- 246607
Transcript NameFunction/comments
Hyaar_Emoy2801471hypothetical protein
Hyaar_Emoy2801472DUF803 domain membrane protein

Sequence
3254 bases(100 bases per row)
CGTTCTTGACGCAGCAATTGCCGCCTCTACGTGAAGCTCTCGAGCGCCACAACGTCTTTGGACTCGTGACGGACGGGAAAGCCTTGACGAAATGGCACTT
GAAGCTGCTGCAGCTCATAGAAGGATCTAATGTATCGCGTTGTGTGGGCTGGAAACTGATGCGGACGACGACGCGTCAGAGCTCGCTGGAACGACTGGAA
GCGCTGGCTGTCGAGCTGCTGGAAAGAGTCGGAAAGCTTTTGAAGCAGCTGCTGTGTAGCAAGGAAGAGGGCGAAGATACAGAGGAGGCCACTGCAGGTG
CGTGTGGTGTCGCTCAAGTGTTGCTGCGTCATGTGGACAGGTACAACCCGGACATTCGTCGTGAGGTGCTGGAGCACCAGGCCAAGCTGTTACAGCCGCT
GGTGGCGCTTCTTCAGAGTAAACGTGAGGGCAGCCAGATGAAGGTTGTGGTGGTTGCAGCTTTTGACTTGGTTGCCACGCTCTTGCGTGTTTCTCCGAAC
TCACTGAGGACGTATGCAGTAAAGATCGAGTCTGCGTGTGCGGGTGCGCTATTTCCTGATGGAAGTGCAGACGGAAAGGTTGAGGTCGTGGCTGAGAAAG
CAGTTGTATGTCTGGCGTTACTGTGTAACGCGTCCGACAAGCCGCAGCAGGTGTGGATGTTGATGGCTCAGAAAGCGTTGGAAGCTGCGCACCAGCAGCT
GGATTTGTTTGCGAGCAAGCGCTTGACGGTGCTTTCCACCGAAGCGATGACAGGAAAAAAGTTGTGGGTGCAGGGAGCAGCAAGTCAGCATTTAGCAACG
TACCACCGTGCAGAGGCGACGCTCGTTAGGATGACCCGTGCTGTGAGTACACTGTGTGAACTGCTGAGTGCACGCACCGCAATAGCAAGTTGTGGACAGA
TCTCTGAGCGCGAGGTGCAACAGATCCTGCCTGAAATCGTGTTATTCGCTCGGCGCGCTATGGCTGTACGTGCGCACGAAGTGGGCAAGCACACGGGTGT
ATCAGATGATGGCGTGCGCCTTCCTGTGAGTGTCATATATGCCATGATTCCGCGTGTTTATGTTCAAGCTCTGCGTGCCTTGAGTACATCAGTGGAACGC
ACTGGACTCTGCGCTTTGCGCCATGCTAGCAAGATCGCACGCGTTCTTTTACTTGCATCTGAAAATGTGGGTGATGGAGAAGATCTGCAGGCCTTGGCGG
ATACTACAGCGGTTTGTGCGCGCCATCTGGGTGCTAGCACTGTTGAAAAGTTTGGTGTGCCTTTGCTGAATGACCTGGTCACGCGTTGTAAGCGCAGTCT
AGATGAGACAATAAGTGCTACCAAAACGACGAACAATCTGGTGGTGAAGCTTGCAGTGCAGCAAGCGGACATGAAGAATAATGGCAGCAAGAGCAAGAAG
CGGAAACGCCAGGCGGCTGCTGCCGCAACTATTGCTGCACTGAATGGAGGGAACACGTTTGCAGGCCAGACAGCTTTCGTGTCGATGCGTGACGAGGGTT
TTGTGACACTGACCCTTGAGGCAGTTATATCAGCTGTCGCTGGTTGTGTGAGTGTGTACGGAAGTTTGCTACCAGAGGATTGCCGTTCATCGGTTCGAGG
ACTGATGCTCGAAGCGGCTCAGCACCAGCACAAGCTGGGGTCAGGTCACAATTGTGGCGGGTTTGACCCCGTAGCGGTAGCGCTCTTGTCAGACGCAGTG
ACTGCTGATGCCGCAGGCTCACACGCTGCTAATCTGCTTTATGGTATTCAGTACTGGCAGCGTCGCAGTATCCGTAGTGGCGGAGCTTCGTCGGCGTTTC
AGCAGATAGCACTTAATGTTGGTGAGGCGATGCTGCACCCGCGTGCACCTCCATTGACCATCAACTTTGAACAAGATGTCAGCAAGGAGCAGAAAAACAA
TGGATACCGTGGACTTAATTCGAAAGCGGTGTTGGGGTCCACTGCTTTGGAAGATGCTATGGAATGGGATGGAAGTGAGCACGATGATAGTGGTGACGAA
GGTGCGGATGATGGGGAACGAGTAGCGAAGGAGGAGTCGACTGAGCCGAAGGCGCCTGCTATTGTGGACGACGAAGAGGATGAGGACTACGATGATGCCC
GTCCGCAAAATTCAATAGAGGAGCCGATGGAGGTTGGTATAGAGGAGGAAGAGAGCAAAATAGATGATGAAGACGAGGAGGATGAGACATCAGTAGAGCC
TGGTCGGAACTGCGCGGACGTCGAGAAAGTGACAAACGCCACCAATGGGGCTGGCGGAGGCAAGGATGATGATGACGATGATGACTTCCCTGACATTGTT
GTAGACGATGACTAGGAGCGCAACTTTCTTTTGCGCTTAACGCGTTTGGTTTAAACAGTAGGTAGCTAGACGCTATATCTAGAGTTGTTCAATTCGCTAC
GACGTACAGGTGCTGTCAATGCCAAACAATAAACTTTTTCGATTGACTCGATACACTACAAACACAGAATAGTTCCTAAGCGCTTAGGTGAGGTCCGTCA
TCTTCATGAGCGCCTGCTGGAAGCAGTAGTGAATAAACAGAAGCGTCCGCACACAGCAACAAGTCTCGATCATCGTCACTTGTACTCAACTTCATCCGAT
CGTTACCAATACGACTCCTTCCGGCCTCAGCTTCCACAGAAGAAGAGCTGCGTTGCACCAGCAACCCGACGCCCAGTGCAATAGCAAGCAATGCCACCGG
GTAAAACACCTTGTCTGTCGTTGATATCGGCTCGTTGTCATTCTGGTAAAAGACCGCACCGCCGACAACACTAAAGGTGATCCAACAAGCTTGGAATATG
GGAAACACGGTCATGATATCTCCTGATGCTGTCGCCATGTTGAGAAAATGCGTCTGCACGAGAATGCACACGAACATGCCACCCAAGAAAATATACGTCA
GGCCATACTTGAACTGGTTGTCGCCCTTGAGAGTGAGGGCAATCGTAATGGCGGAGCACTTGGCTAGCAGCACTGTCATCGCACCCACGATACCCGAGCA
TACAGCGTAGTAGTAGGGAACCCTAGACGTAGACTTTCCAACCGCAGCTTTACCATTTACATCCACATCCTCCGCACTGGTAGAATCAATCAGCTCGCGC
AGCTCTGTGCTCATGGCAGGAGGATTCACAAGACCAACTGGGAGCACGGAAGCCGACGTACTAACTTGCAGCAGCTTCACTTCTATATCTAGCAATCGCT
GCTCAAGTCTTTGGACTCGGAGGTCAAATTGCTGCGCAGATAAAATCATAGAAG