Description :
From Genome Similarity Track
Location :
Scaffold_185:24335- 29870
Sequence
5535 bases(100 bases per row)
ATCTCCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCCCAACGTCTCGATGAAATGATCCACATGTTCCCGTAGTACCTTGGATCCCCCATCCT
TGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGC
CACCGACACTCCCAATTCACAGTACTGGGTCTGGAAACTGCGCAACAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAATTCCTG
GCTGGCCCCGCTAGCAAATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCG
CTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGC
GGCTGTTGCTACCACCGCCGACGAAGGGGATGGGCCATCCAGATCATCTAGGTCGAACTCATCATGGGAGTTGTCTCCCTTCACGGATTCCATCTCCACG
TCTCGTGCTCCATGTTCGTGAAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGCCGTT
GCAGGGTGCCCGCGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAA
TCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAAATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACAGGGGCT
TCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGCTCGGACGACGTGTCGGACCCATCTTCCG
CCGCGGATTCGTAGTTCGAGGACACAGCTTGGCTGATCCTCGGTGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGC
AAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAA
CGTAATCGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTTGATCTGTCGTGGATTCAGGATCCGCA
GGACAGGATCTTAATGCCGAAAATCGCGTAGAGATTGGTTGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTGGACCTGGATCCAGCTTGGTCTTC
TTCCGACTCTAAGGCTTGCATCTTCTTCCGCGTAGGCTTACTCGTTTTCGTTTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGTTGTT
GGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTGCTTTGTTTTGCTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCTCCG
AGGGGACCTGAGGAGGATAGAGGGGTTTCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGCTCCTCCCAAAACTCCATCGATCCGCGGATCT
TGTTTCATTCAGCAGCGTTTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCGGCTCAATCTTCACTTGAGCATCTTCTTGGGACATACGGGGAAATC
GCGAGTCACCAAACGATCCGGGCGCGCGCACGATTGTCGTGTAGGCGGAATCGGAAGAATCTGCGAGATTGCTGGATCAACTTACCGACAGCGCGCAGAA
CAGCTGACTTATCGGAGGAGGCCCTCCGTTGATCGCGTGTTCTGGTTGAACTTTCGTACACGATGATTACCCGGCCGGAAAGCAGGGATCCTATGCTCTC
TTCGGAAGCATTCGCGAAGAGATCAAGGTGGTGAG