Description :
From Genome Similarity Track
Location :
Scaffold_3:2433327- 2435618
Transcript NameFunction/comments
Phyin_T30-4PITG_02526Dynein heavy chain

Sequence
2291 bases(100 bases per row)
ACTGTTGTCACCACAACATCAGTCGACAAGACTTGGTGGCTCTCAAGATCCAGCTGCGGAATCGATCGCAGCCACTGGCGCCATTCACCATCATCGATGT
TAACTTCGTACTCAAGCAGACCGTTGTCCGGACTGGACGACGCAGCAACAGGGAACACCAAACGGTTTTCTAGCGTTTGCACCACGAAATCGCACAAAAT
CATGCGGTTGGTCGAGTCCATGGAGCCTCCGAAGCCCCACAAAACAGAGAACACAAACCACTTCGGCACAAAGCGTGACATCTGCTCCATCGTCATTGGG
AAGTCTGAGTGGCCTTCGTTGTACTCGTTGATGCGCGACAAACCGCGTCCAAGTAATGTAAACATCGACATTAGCAGACGCAGCGCCGTGACCTCCATGA
TGTGCACTTGGCCCATTGCCTGCTCCAAGCAAATCTCGATCAGCGAGGTCATGCCATCTCCACGGTTAATCAGATCTCGGAGAAGAGCGACATAGGTGTG
CGCAGTCTTCTTTGCCAGCTCACTTTCACTCGGCTGGAGCGAGAACGAGGACACAACAGACACGTCATCCCGCATTTTCAGTAGATAGTGCTCGACAATA
TGACACGTCTTGACTGTGTCATGCGAGAACCAAACCATGCCGCAGCGACTGACAGTTGCTAGTGTGGCGTAGCGCAGAGTCTCCGTCTCCATCATGATCC
ACACATTCGGCGGGATCTCGAGACGTTCGCCTGACGGGAGCGTCAACAGGCGGTTGTCATCCAACACAGAGTTCAAGTTCTCAGCCCATTCTGGACCCAC
GTCGCCGTCGAAAATGATCCAGTGTCGCTTTTCGCTTTCACCTCTTACGCTGTTAAGCACCTGTCGGAGCAAGTGGGTGAACACACCGTCCGTCCACTCA
AGCGTCGTGTTATCAAGAACACCGTACAGATGCTCCTTCGATAACGCCTTGGGATCAATCACATGAGCTTCACCCTTCACACCATCAACAAGCTCCATGG
CGTTCATCAGCACACGCCACGCGCTCGACTTTCCAGCTCCAGAAGCGCCCACAAGCATCACACCGTGACGAAGCTGCATTACCTGGTAGAGCTGCAACGC
CTTCTCCACCCACTGATCATTCGCAACGTAATTGTTTTTCTTTGCCAGTTCAATAATCCGAGCGCGGAGGTCGTCTTCCTCGATACGATGCGCTTCCGTG
CCCGGGAAAACGCCCTTCAGAAGCGTCTCAAATACAGGAACATCGTTGGAAACGAGCTTGGGCAAAATTGTGTCAGTAATAGAGCCGATCAGCGCCTTCG
TTTCCAGCTCCTCAATGCTTGCAGGCGCCGCACTTTCTTGCGACTGGGTGATCTTGCGCTTGAGCTGACCAGCACTTACAAGCACGCTCTTCAAAGCGCG
AAGTCCGAAATCATAATGAGGCTGCTTCGAGAGCTGGTCCTCGCATAGGTTGAACAAGAGCACAACCTTGGCCGAGATCTGTTCAGCTGTGGTAATACCC
TGCGAGAAAAGCATCACTTGTGCGATCAATTCGCGGTCCGGGGCAACCATTGCGATGCTGCGGAACAGTTGCTTCAAGTTGTCCGGTAGGTTCGATCGTC
CAGCGTAACCAGGGTTCATCGTCACAAATATACCCACATCGGGGTTCAGCTTGACGCTCTTGCCCAGCAACTCGATGGTAGCGGTGGAGCTGCTGCTTTT
TGTAAGAGCCTGCGTGTTGTTCGCTGCCTTGCCGACCTTCAACGAAGACACTCCACTCTGGATCGCCAAAATCTGTTGAGAGACGGCAGAAAGCACACGC
TCCTCGAGACGGTTAAACTCATCGAAACATCCCCATGCGCCAACTTGACACAAACCAACAAAAATACGACCCATCGCTTGGAAGTCGAAGTGCTCGTCAC
AATTGAAGACCAATACAAAGCGACCCAGGTGAGATCCCAGAGCCTTAACGGACTCTGTCTTACCTGTGCCGGCAGGACCGAACGGGTTTCCACCCATTCC
GAAGTCTAGCGCTTGCGTCAATGTGAGGTAACAACGCTCCGTAAGAGGGGTCTGCACAAGTCTTTCGCCGACGCCGAAGTACTCGAATCCATACGAGAAA
CTGGCGTTGGAAATCTGGATAGTGAGTTTCTTGAGCGGATCGGACTCCTTGGCTTGGAAGTAGTGACGCATGTGATACAGCCAACGGAAGTCCTCTGCAC
TGCTCACCTTGGCCTGACTCAAACGCTTGGTGACGCTCTTCTGATGCACAAGCTCCGTGATCAGCTGCTCATACTTTTTCCGAACGTCGTT