Description :
From Genome Similarity Track
Location :
Scaffold_1404:2433- 4955
Transcript NameFunction/comments
Phyra_86954poly [ADP-ribose] polymerase, putative
Phyra_86955taurine dioxygenase, putative

Sequence
2522 bases(100 bases per row)
CAAGACGTACGATCCGATCCCCGTGCTGCCGTACAACGACCGCGCGCTCAAGGCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACGCAC
CTGGAGCCGAAGATTGGCACGGAGATCTCGGGTCTGCAGCTGCACGAGCTGACGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCGGCG
TGGTGTTCTTCCGCGAGCAGGAGATCTCGATCGAGCAGCAGTTGGATCTGGGTCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGCGAA
GAGTATCCCGCAGGTGCACGTGGTGGAGAACTCACTCGAAGTTAGCGAGAAGCGCCTAGAGACTCAGCTTTACAGGCACTTCAACCAGTGGGTTTGGCAC
AGTGATGTGTCCTATGAACGTCAGGTGTACTGCGGATTCTTTCGTAGAGTATACCGAGTGCATTTACTGACAGACTATTTTTGGTTGTTGTTGTGTGCAG
CCACCTTCCTACACGAGTTTTAAGGTCTTGACAACGCCATCCACGGGTGGAGACACCCTCTGGGCTTCTGCATACGAAGCGTACGAGCGCCTCACCCCGC
ACTTTAAGGAGTTTGTGGAGGGTCTCACTGCTATCCACAGCAGCAAAGTAAGCAATAAGCTCGCGTTGGTGTCTTATTCAGAATCTCAACACAGTTTTTT
ATTGGTACAGCTTCAAGCTGAGGCCACGATTGTACAGGGGCATACTCTTCGCCGCCCCATCGTGGAATTCGAGCACCCGGTTGTTCGTACCCACCCGGTG
ACTGGCCGCAAGGCGCTGTACGTGAACAGCGAATTCACGACTCGCATCAAGAACCTGTCGGCGGCTGAGTCGGGTAGGTAATTGACACTTTTACCTCGTG
CTGGATTCAAGTAGTAATTTTTTTCTTGTACAGATGCTGTGTTGCACTTCCTGACGAGCCACATTGCCCAAGGATACGAGTTCCAGGTGCGTTATCACTG
GACCAAGGACGCGGTGGCGATCTGGGACAACCGCGTGACTGCTCACTACGCTACGTTCGACTACCTACCGGGCAACCGCCATGCTGTGCGCGTGACGCCT
CACGGCGAGGTCCCGTATTTCGAGCACTCCGAGTCAAACTCCGAGAGTGTCAAACACCCGTGAGCGTGAGCTGCATCTCGGTGTGATCGAATGCCTTACT
CATACCCCTTGATAGTGACCAAGGAAGAGTAGCGTGGTGATTGCGTCTCCGTTGAAACATGACAACATTGTATGCGGATTTAGTGAAACTGATGGAGACT
GCACTGTATTCGCCCTCGTCACCCTAACATGGTCAATTCACAGCCGCGGGCTTGCCGAACCAGTTTGCAGCTGTCCTTATGTGATGTCGATAAAAGCAAC
ATGCCCATCACTGGTATCATTTGGATAGTCGACGGTCTCTGCTGAGCCAATGCGAAGCGCCCAGGATATCACGCTGTCCATGCCCCCTACCAATTAGCTC
CGCGATCGAGCACCTATCAGCTCCATCATCTGCGCGGAGCAACCTACAACCCAAACGCCCACCAGAATTCCTTTCGTCACGGAAGCGCTCGTGCGTGTCT
TTGGCGTACGCGCTCGCTTTCTGTTGAGTGAGCGCCGCACGAAGTGGGCCCATAGCTAGCGTCAACGAGTATCTTGCGCAACACCAGCTGCCGTGCTGCG
ATACTGAGCACCAATCCAAGTTCAAAGCATCCGACGCAAGTCGACCTTCGCTCGAGCTAACTCGCCCGCTGCCGTTGCTCACTTTTCAACTTGCACTCAA
GCGCCATGGCCCCCATCAACATCGACTCCACCTCCACCACTGCCGGACCCACTGCCGCGGTGGTAGTCACACCAATCAAGAACGCGCTCAACCAAGAGGT
CGAACACGCACCCTTCACCCACCCGGAGCTGCTCGGAGAGTTCCCCACCAAGACGTACGATCCGATCCCCGTGCTGCCGTACAACGACCGCGCGCTCAAG
GCCGATCCGTCGTTCAAGAACCTGCTCGCGGATGCGACGGTGACGCACTTGGAGCCGAAGATCGGCACGGAGATCTCGGGTCTGCAGCTGCACGAGCTGA
CGGACGCGCAGAAGGACGAGCTGGCGCTGCTGGTGGCGCAGCGCGGCGTGGTGTTCTTCCGCGAGCAGGAGATCTCGATCGAGCAGCAGTTGGATCTGGG
TCGCTACTACGGTCCTCTGCACGTGCACCAGACGGTGGCTCACGCGAAGAGTATCCCGCAGGTGCACGTGGTGGAGAACTCACTCGAAGTTAGCGAGAAG
CGCCTAGAGACTCAGCTTTACAGGCACTTCAACCAGTGGGTTTGGCACAGTGATGTGTCCTATGAACGTCAGGTGTACTGCGGATTCTTTCGTAGAGTGT
ACCGAGTGCATTTACTGACAGACTATTTTTGGTTGTTGTTGTGTGCAGCCACCTTCCTACACGAGTTTTAAGGTCTTGACAACGCCATCCACGGGTGGAG
ACACCCTCTGGGCTTCTGCATA