Description :
From Genome Similarity Track
Location :
contig_134:24329- 26067
Transcript NameFunction/comments
g13667.t1hypothetical protein

Sequence
1738 bases(100 bases per row)
CCGACACCGCAGCGACAACAATATGGTCAGCACATTGGCCAACATGGCAATGGAAGGTGCTATGAGCACACAACTAACGATCAAGGGACGGCCAGAGATG
ATCAAGAAATATGCAGGGGTACTTCGTCATATGGGCGAAGACATGACAGGGTGAATGGACAACCGATAAGGTCGCCGGCACGAAGCGGGGAAGCGAAAGC
TTGGATCGCACGGAAAACGGCTAGCAATCGACATAAGGGCGGTAGCTAGGACGGGCATAGGAAGTCATTAGTTTTACTAAGTGACATCAATGTACCTCAC
TGAAAACAAACAAAACGACAACAACAAACAGGTGCTAGAGGTGTCATTATCTCCAGCGCATCAAGCAGCAGACCCACAGCCACTCAACTGGAGGTTGCAG
CCGCACCCGAACGCGATCCGAAATCAGACCTTGCTGTACGTTTCCGAGGAATTCCTAAGCCCGGGACACGACTTCATAGTGATCTCACGCGGTTATTACT
GCACGACGCCGCACAACTATCAACTGTGGTTATTTGTTCAACTGCTTCCTCATCCGGACTGTTGGTATCTCTCCGACGAAGAGTTTGACAACGGCCACTT
TACGCGTATTGCAAGCGGTGCAACATGACGATTGCTTTCGTGATTCGGAACTATAAAGTGCCGGACCACATGAATAATTTTCACACTACTTGTGCTCTAC
TCGTCTTCGGTCATTATTGCCATCAAACCCGCCTTGATAGTAAGTCGTGCCGATGTCGAGCAATATGATCCGCTTCGAACAATCACTGCGTTCGCATCCA
TACGCTGCGGTTGTGAGCTCGCCTGTTTCGGTTGCTTTCATCATACATTCCTGTGCGTTGAGATCATCTGTAGCACCCATAGGCAAGACATGCTTGGGGT
TCCTTGATCGATTACGACGGTGTGAGTGTGTTGATTCACGTTAGAAAATGCAGGAAGACGATACCTTGGCTATGGCGGAGAAATACTTGGTCAATACGTG
AAGCAAAAGTGCCGCCCGCAACGAAGTTGAAGGTCGCTTCACTACGCATTTTCAAACTCGTCGCTCTCGTCGGTACGATAGTTCTCCTGCACCTTGGAGC
AGGGCTGCATGAAGGGGTGCATGTCGTGGAGGAACTTCCTCTAGCAAGTCTGGAGGTTGTACGGTACGGTAGTTGAGCCGCTGAAGGCCACCGTCTGTAC
CACCACCTTGTCACTGTACTGCAGCGCCTTCATCACCTAGGGCAGCTCGTTGGTTTGCTTGACATCGTCCTTGGTCTTGGCCTCCAGCAGCTTGACATCC
GCCACTTGTGTGCGTCGATACAATTTTATACTTGGCTTTTGTATGTTAATAATGTGTGGGCCACAGAGATAGAGGTTAAGCCAGAGGTAGAGGTAGAGGT
GAGGTAGAGGTGGGGTGAGGTTAGTTAAGCTTAGTTAGCCAACCACGACAGCTCTATCGTTCACGACCCTGTCATCACGCACTGGCGATTGGGTTGACTT
TGATATCATTTGCTGGTGGGGGTGCCGCACAAAACTGCCATAAGGGTGTCATAAGCAAGCTCTAAATGTGTATCTAAACATAACAGCTTCACACGTACTA
CATGTATAAGTGATAGGTTTCGTGATATACGCCGAAGATTATGGTGGTTGCTTGTTGAGGGTAGGATCGCGACCTTTGGTATATCTACATACTGAAATGA
AGATAAAATGTATGTAGTTGCCAAATAGAACACGCGGT