Description :
From Genome Similarity Track
Location :
Scaffold_10:243249- 248254
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004692related to a-glycosyltransferases%3B membrane anchor near C-term
Pytul_DAOMBR144PYU1_G004691Similar to odc: Probable ornithine decarboxylase (Dictyostelium discoideum)

Sequence
5005 bases(100 bases per row)
ACTTGACAGTGCTTGCTGTAAAGCGATGTGTACGGCGGGTCAGAGGCGGATGCGTTTACGAACGCCGCGAGTGTCAGTATCGGCCAAGTGGTCAAGTCTG
ACTCGGTTCGGAACGCTGTGGCTGCTCTATACGGACTGGGACTCAACTTCACCGACACCAACGGCGTCTACAACGGTGGATCACAAGGTAAGTCGACCAC
GCTGCCACTGAACGCAGGTGAGTACGTCAAAGCGCTCGTGATGCTACCACCAGTACGACAGCGACGGTCACTGCTCCGAGTGGCTACCAGATCACTGGGT
TCAAGGGCACTTCGAGTAATTAGCTGAACTCTCTCGGCATTAAGTTCACGCTTCTTCCACTACCGTAATCCCGTATCGAAATGCAAGGTCGGTTCGTACT
TGGGTACAGTGCAAGCGTGTATGTACCAACCGAACTAAACGCTTGCGTACGGAGATATAGCAACTCCTATGGCACTCTACGCTTTCATAGCAGTACATGA
TACTACATGTTGTAGCAACAGTGCAGTTGAACTCCGAACTAGCACCAAAAGAAGACACTTTTTTTATTGAATTTAATGGACGCACATGGTAGAGCACGGC
ATAGGTGGACAATTTGGATTCGTTTTGATGCAAAACCAATCCAAGCTGTCCATCTGCATTATTCATATGATCGACTCTTTAAAATAATATGTAATTAACG
AGGTATATCGGTACTATTTCGCCAACCAACTTAGAGAATCAGCATACCCATCACACAATAAGATTATGCAAGGGGGCCAGTATTCGGAACCCAACGCTAG
TGGGGGCGACCTGCGCAGCAGTCAGACAACTGACGCCCCAAGCAAGAACGCGCAGCCCGACGCCCTCGCTCTCGCTGTGTGTGCGCGCGCGCGTCGATCT
CCGTACACACGCGCCTCTCCCTCCCCCTACCCCGCGGTCTCCGTTGCAGTCATGGGCGCCGTCAAGGCCTTCGCGCTCAGGTTCCTGAAGCGCCACGTCG
CGCTCGTGTCGTTCGTCGCGGTGGCGTCGATAGCGGCGGCAATCGTGTACGAGCTCACGCACGGCGGCAAGCCGCACCGCTGGGTGTACGACGACCCGCG
ACTCAACTACGTGGACCGTACGGGCGACAAGCCGCGCGCCATCTGGAACGAGGACGAATTCGAGTGTATCGGATGGCGCGCCACGTACGGCTGCGACCCG
TACGGTGAGCGCGACGTCACTCGCGATCGCAAGTGCGACGAGCCTTTGTCGCGCGTGAGCGGCTACTGCGAGGTGCGCAATGCGACGTCGGGCGAGATCT
TCCGCGTGATGCTCGCGACGTGCAAGTCGTGGCGCTGGTACCTCGTCAAGCAGCTCACGTGCAACGACGCGCGCATCTTCACGGACTTTAGCATCCGCGC
CGCCGAGTACGAGCACCCGCCAGCGATCGCTGCGCCGCTGCCACCGCCGAAGAAGAAAAGCGCGGACGACAAGAAGAAAAACAACAACCAGATCACAGCA
ATTGAGAACGACACGGCTCCAGTCTCACTCAAGCGCGGCGTCGTGCTCATCGGGTTCCCGAAGGCGATCGCGGGCGTGTACGCGATCATCCGCTTGCTGC
GTTTCCATGGATGCGCGCTGCCTGTCGAAGTGTGGATCGATCCGCTGGAGATGCACGCCAAGCACTCGGTGCTCGTGGAGCTCGTGAACAACTACGGCGT
GTTCCTGCGCGTGATCGAGGACCCGAATGCGACCAAGTTCCACGCCAAGCCGTACACGATCTACCACTCGCGCTTCGAGAGTGTGCTTTTCCTCGACTCG
GACAACATCCCCGTGCGCGATCCGACGTACCTCTTCGACTCGCCCGAGTTCACCAAGTTTGGCGCGATGTTCTGGCCGGATTTCTGGCGCCCGGCACTCG
ACACGCCGTTCAACGTGCAAGAGCAGAGCGCGCTGTGGCAACTACTGGACATGCCGTTCGTCGACATGTTTGAGCAGGAAAGCGGCCAAGTGCTGGTGAA
CAAGTCCATGAGCGCTGCGGCCATGAGCAAGCTCATGTTTTACTCGGACAACGTGCCGCGGCTGCTCACGGACTGGGAGCTGGTGTACGGCGACAAGGAT
CTTTTCCGACTCGCCTGGCTCAACACATCGACGCCGTTCTACTTCATCCAGCACACGCTCGCGCTCGGCGGTCTCTACGACAAGGACGAGGATTTCTTCT
GCGGTATCTCAATGATCCAGCGCGACCCGGCAGGCGATTTCATCTTCTTGCACCGCAACCAAGCGAAACTGAGCGGTCGACGCGACCAAAAGGTGCTGAT
CACGCATTACCAGAAGTTCACGGGCGGCGATGGCGGCGCGACGTCGCTCAAGCGCGACCTTGACAAGTACCGCATCCAGTGCAAGATGCACCGTCTGGGG
CAGTACATCTGCTTCCTGATGAACCCGAAGACGCTCTCGGGTGACGCGACGCCGTTCCTGATCAAGAGTCTGGACGGCACCAAGTACCCTCAGGTGGAGA
AGCAGGCGATCCATTTCTCGATCGAAGGCCGCAGCCTACTCTCCAAGACGGAAGAAGCCGAGATCGCGGTGCTCGAAGAGAAAGAGCTGCAGAAACAAGC
CGCCGAGACAGCTGCCGAGCTCGCGAGAAAGGAACACGATAACCAGACGTGGTACACACTCATGTTTGGCGGATGTGTGCTGCTACTCGGAGTCCTGTGG
AAGTTGAACTCGTACCGCAAGCGGCAGACACTGCTGCCTCAACAGCAGCAGCAGCAACAGCAGCGACCGAATCGGCCAACGTTAGGATCGAAAGACCTGA
GTTTGGCGGACGACGCGTCATCAGCGTCGTCGTCGAGTGTGACTCCAAGTAGTAGTGCTGCGAACACCGCGAATACGGTGCGAAGGAAGCGGTCGATGTC
CATACAATACGACGACCAGCATATTCTGTAGCATGGAATAGAAGCAGGCATGATGCAAGTCAATTTAGGGCATTTTTTGCTACCTACTAAGTGCGATAGG
TATCTGCTACTCACAGGGTTTTCCTTCGCGTCCTGATGCGTGAAGCTTTTCTGGCTGAGGAGCTGGTTACGTGCTGCACTCACCGAACATGCATGACCAA
AACCGCAAGTTGTAGGAAAGATATGCTCGCCTAGGTATCCGTCATATGTGGACGGAAACTACTTTGCTCCGAGCACAAGCACGACGTCACAAGGCGTTGC
CATTGCTTGTGAGATTTGCGCTCTGAGTGCTCTCTGACGACGTGTTTCCAGCCGCTGATTGGCTGAAGCGCGAGCCAAAGGGTGAATGTTGGTCCCTGCA
CTGACTTATCTAATCCCTCGAAGGGATCTATGGCCACGTTGCATGCATCTGACTTTTTTGGCGCTACTTGATAGATCCTTCCTTCTCTCCTTCCCCTACG
TGCGTGCTCAACGGATACAAGACGATCTTTCGCTCATCCGAGTGCTCGCAGTGCCGCCAACCGACCTCTTCTTGCACGACCCATTTAGGAAGGGTGCATG
ACGCCGCGACTGAAGAAAACTCCCTGGACATGGCACAGCCTCTCGTTAGTGTAGAGCTGAGCGAGGTGTTTTGGATGTGAACAGATGCACAGGCAGTGCG
CTTGTTTGACGATATTCAAGTGCAAGGACAATCGAACGCTTGTATTTCTGGAGCAAGTAAAACTGGGTGCGCTGAGATTGCGTTCTGACCACTTTGGCCA
GCGACTCGCATTTTCGCATGCAGATTTCGCATGCAGAACAACCCCCTCAAGCGATCAGCGAAATGGGCTTCCTGCTGCCCTCAAGAGTGTGGGTGCTCTC
ATAGATGGCTTAAGCTTCTTATATTCCTTTATTATGCCTGTGGCTGCTAGGAGGAGAGGGGAGACAACGAACTGCAAGAGGAAAAGGAAGAAAAGCGACG
ATGCAACCCCCATCGCGGGCACCTGCTTGCTTCCCAAACCCCCTTCTTCTGCGTTTCCCTCCCTGTCTGTCGGCTCCGCCTGAGCCCTCAAGTCCCTCCT
CGCAATCCAAAACAAGGGCTGGCTGTGCGTGGTCGTGCTGCTCACTGCACACTGAGAGAAGCTCTTGTAACCGCTCTCCCTCTTTCTTCAATGTTCTCGC
GCAAAGTGCCGGTTTGTTCGCTCATTAGTGAACAAACTGCTGCTCCTGCTGCGGCTCTTGCGCGGCCTCGTTGCCGTCAAAGTAGATCTTTTGCGGTGGC
GCGAACCCGTTAAAGTCCGAGCCAGCGGCACACGTGTACGCGCCCATGCTCGGGAAGCAGATCCACTGCCCGATCTCCATCATCGGCATCTTGACCTCCT
TCATGATGCAATCCATGCCATCGCACGTCGGGCCCCAGATGCTCGCCGTGTGCGTGTTATCCGCCGTCGCGACGTCCGAGACCACGACTGGCTGGATCGT
CGGGTGGTCGTACACGAGGCAGTTGAACGAGCCGTACAAGCCGTCGTTGACGAAGTACATGTAGTTCGGCACGCTCTCGCCATTCTCCGAGGTCGTCGCC
ATCGCGGCGTCAGGCCCCGTGCCGGGGATGTCAAAGGTTGGCGCGACTTTGCGGCCGATCACGTTCACGGCCAACGTGTGGGTCGAAGCCGCGAAGAAGC
GGCCCGGCTCCGAGATGATGCGCACACCGCTGGATTCCGGAAAGTGCTGTCCGAGCGACGACTTTAGCTCCATCGCGCATTCCTCAAAGCTGATCGGACC
GGTCTCGGTGCCAGGGAAGCCGCCACCGATGTCGAGCAAGCTAAAGTTGAAGCCGAGCGATTGACCAATGTCGAACGCCTTGCGCGCGCGCGTCACGGCA
TCCGAGTACGCGCTGACGCTGAAGCAGCCGCTGCCGACGTGGAAGCTGACGCCGATGACGTCCAAGTTGAGGCTCTTGGCGTGGCTCAGGATCGCCGGCA
CGTCGTGCACCATGGCGCCAAACTTCGTGCCCAGGCGGCAAATGGCCTTGGTGTCGTCGACGTACAGGCGTAGCACGAGCTTGGCGTGCGGGTTGATGCG
CTGGA