Description :
From Genome Similarity Track
Location :
contig_71:243241- 247950
Transcript NameFunction/comments
g9669.t1hypothetical protein
g9670.t1mannan endo-1,4-beta-mannosidase, putative

Sequence
4709 bases(100 bases per row)
CATGCCCTGCCCATCAAATAAGTGAGTACATAAGCTACACGTGCAGACTCTGCACTACTTACATATAGCACATCTCGTTTCTGCAGGACTCCGCCCAGTG
CTTCGCGAACCTTCTTGTGGTTCTTTAGAATAGCTTTGAGGTGTCGATTGACTTTCTCTGCTTGTAGCCGTCGTCGATACTGTTCGATTGCACGGCTGTG
CCATTGGTTCTGCATGGATGTCTCGACTGTTCCAGCAGTCGGTAGATAAGCGATGCCCGCGCGTTTTAACTGAGCCAGAACGTCCTGCAGCTCCTCCACC
TGGTCACGTAAACTCGCCAGCTCTGCACGTTTCCGTCGCTGAAGTCCAGTCGACGAGGTCTCGGCACTTCTCACTCGACGCTTTTTCAAAGGTTTTGACG
GTGTGTCGTCTCCCTTCTGCGGAATTTCTGGGGCCGTGTGTTGGTCGCTTGCTGCCGGGACATCTGGCAAGTCGAGCAAGTCGTCAAGCAAAGGGACGTC
GTCCAGGGCGCTGCTCTCGTCCGTCGTATCGACCGAGTTCTCGCCGCTGCAGGCCTCGATGAAGGCGAACGCCTCGTTCAGAATAGACTTGTTGTCGTCG
GCCTCAAAGAAACTCATGCTGAAATCGGTAAATGGCGATCGGGAGGGAGGGAGGTCGGCCTTGATTACGAGTCTGGCCCACACCCATAATCTACTTCGTG
AAGCGATTTTGATTGGATAAAGTTTATTCCCACCCAAACAGTATTACACTGCAGAGATCTAAAATATAAATGAAGTTGTATTCCCGGCGCAAGTTGGAGA
CGATCGTCGAGAAACACGAGGCAGATGTTTGATGTTGCAATGATATAATTATGCACGCTAATTCCCTGAGAAAGGCCTCGACTTGCCCTATCAATGTGGG
CGCTACTCCCTAGACACTGACGGAGAAATCAGGGCCGTATCTTCGACAATTCCATTTGTGTTGACAACAACCACAAACGAAAAACAACACTACAAATACG
GTAAATTCCAACATTGCGATAGCCATACCATAGCGGTATCGACAGCATATCAACTCTTATCGAACAGTGTGACTGGTCGACCGTTCAGTAGGCGGGTATG
GAGGCGGGGCTCTGCTGTGATGACTCGGTGCAGTTGGCTTGGATCCTCTGGAAGTTCGACCACATCATGTCGCCCAAATGCTGCAAAACGAATAGCTCTG
TTGGGTCTGTGCCTTGCGCCTCAAAATCCGACAGCGAGTACTGATCTGAGTTGATTTCTGGGGTCAACCGATAGTGCGACTGCAACACAGTCCCCGTGGA
GGACCTTGTGACTAGAATAAAACCCTCTTCGCGGAATCTCATCGCCGTATTCGTCGGGTGGTCACACACCAGCGACGAGAACGTGAATAGCAAGCGGTTT
TCTTCCTCGTGACACCGAGACAGCGACAACGTGCTCAGCTCGACAGCCATGTCCTGGTCGCGCAACTCAAACTCGGTTCCTTCTTCGTCCCCTGCTCAGT
CATGTATTTCCTCTATCAAAGCAACATAAAAAACGTTAATCAACCACCTCAAGTGTAACTTTCATCTCAAAACTCACGTAGTTGTTGTAGTGGCATGCCT
TCAAGTCCATCATCGCCTGCTCGGTCTGTTTTAGATCCAATTGGGTAGCCATAGCAGTCCTTAACTCGACGTACGGCATGCCCGTCACCGCATCTCGTCT
CACTTGAACGCCGGTCGAAAGGTCCTGTACCAGAGTGTGGTCCAGCGACTCAAAAGTCGTCGTGACATCCACGTACAACCTGCCCAATCTGGCCGAAAGT
TCCCCATAAATGGCATCGTTCAAATTGGGCACGAAACCCTCAAGCACTGAGGGCATCGTGGGCAAAGGCGTCCTCAATGCCTCTTCAATGTGCACCACCG
CCGTCACATTGCTCAAAACCTCCTGCACGGCCTGAGCGACTTTACTTTGTCTGGCCAGCACATTTTTGAGCTCTTTGTTGCGGCCTTCACTCCGTAGTCT
CAATTGCTTCTCCAACTCGGCCTTGTTCTTCCAGAGCTGCGTCACCTTGTGCTTTTGGGTCGTATCCAGCTTTTGACCCAATTCACGGCTCGAAAGTGTC
CAAACGCTTTTTAGCAATTGGGTCTTTCAGCTCTTTCAGTTTGGTCTCCAGCGCCGTCACTTGGGCACGTAGGGCTAAAAATTGGGCTTTTTCTTGTGCT
GGCACCGACGCGAAGCTGCGGCCTTCCGCGTCTTGCGGCGGTCCTCGGAGCTCGGGGGAGGCGAGTTCTTGCCGTCGTCGCTGCTGCTGCTCGTTGAGGT
CGTCGTGTCGCTGTCGAACGTGTCGATGAAGGCCAACACGTCCGAGAGCGTGGGCTCCAGCTCGTCCAGCGGCAGGAAGCTCCCCATTTGCCCAATTAAG
GACGATTGAAGAATGAGGAATGACTGTACCGGTATCGTGTTACCCATTTGCGACATGCAATTCGCTTTAGTGTCTTTACGACTGGAAACAGTAACATACT
TCATTTGTGCAGAGGAATGTTCCCAAGTTTTATCCACGAACTATAAGCAAGTACTATTTCGTAGCAATGTGCAGGCTCGTATCATCACTATTAGAACGTT
ATCGAGGTCAAGTTGCCGTCCTCGTCGATTTCCAGGCTGTCCGTCGCAAATACATCGTCCAGCAAAAGCCTCTCCATCATACGCTCGATTTCCTGGTTGT
CTTCAGCTACTGTTTTCACTGACAAATCCATGAACTGGCCCAATTTCTCCTTCACTTCCTCTCCGCTCTCTTCAAAATGCATGGGCGTTAAGCGTATACA
AGCCTGAACTAGTGTCGAAGCAAACTCAGCGTCATTTGTTGGTGCGTGAACGACGCACCATCCTGTCTCGTCCAAATTCAAACCAGAGAACTCCTCATCC
GCCTCTGAAAGTGAACGCCACACGATCACGTGCCGGGATTTCTCGATGTACCGTCGTGCTACCTGGTAGGTCTTCAGGGTAAACACCTCCCCGTTCCCTC
GCTCCAGAAAGGAACAAAACTGCACCGCCTTCGAGTTTTCCGAGTCAGGCAAACCATCGTATTCGTGCCGCTCGTTTTGCCTATGAGGTGCGCAGGATAG
CTCCAAACTGCATCACTAGTCCTTCGGAAATCGAACGGGATCTTCCCCACCCCAATATTCTCAAAGCACTCGGTCACTCCATTCAGCTTCCTTGTCGGTT
CTCCACCTAAATCATCCCTGGCGTCGTGTTCGTCCCCACCTCGGCAAATACCTCGTCTACTTTTTCGTAGAGAGTGTTCAGACTCTCGGCGTAGGTCTTG
TAGAGCGTTGCGTCTTTTGCCTTGGTCCGTGCCTTCTTCTCCCCCAAAGCGTCTGAGACTGCCTCGACCACCTTGTCTGCCTCTCGAAGTCGCTTGTTCA
AAATACTTTGAAAGTCCTTGATCATAACAGCCCGACTGTTAACTGCAGCACGAAGCCTGTTTTGCACGTCTTCGGCCTCCTCTCTCCTCTCGTACTGCTT
CATTGCGATTGCTCTCCACGCTCCAACAGCCAAGGAATCTCTGGGTCGAGCTTGTGTTTTTTCTCGGTTCTTACGCTTCTTCAGGTTTGATAACCGTTCA
CTCAACTCCACGTCTTGTTGGCGTAAAATTGCCCATTCCACTTTGAGTCTGCGTCGATACGCGTCGCGTCGCTGCCCGGCCTTCTCTCTGGCAATGTCGC
GGTTGGTCTTGTTCGCTTTTCCAGCGTTTGCACTTGCAGAGGTGGCACTTTGAAGTGGTAGAAGCAAGGCATCCATGTCCGCTAGAATCGCTGGCCGTCT
AGTTCGTCGAGGTTGAGGCCGCTGTCATGCGTTGCAGGAATGTCTTGGGACAGAAACCCGTCAATATCGCGCAGGAGGAGCTGGTTGTCTGTCATCGTCA
AGGAATATCGGCGAGTGAGTGAGCACTGCTCACTGCGAACAGGTGAGTGAGCGCTGCGGGATACCGCCGTAAGAGCTGGAATCTATACCGGATACCGGTA
GAAGTTTCCCCCTCCTCCTAACTGTAATAGAGCACTCCATACGATATCCCGTGATCATGCGTGCCATCATCAGGTTTCTCAAGATTTGCCGGCCATGAAA
ACTTCGTGGGCCTTCTGTATCGATGACGATCGTGGTTCACCTCTGAGCATTTGTTTTCCATGATTCATACGTACACTTTAGCTTGCGTCCACGAGCTCAC
AGCTCAAGAGTCATTCTATAGTTCACTTCCTCACTCCAAAATACTCGATGATATCGCTGTTTCTTGCCCGAGAGCCAGGGATTGCGGGGATGTTTTGCGT
CATGCTGGGAGCTTCAGTGGCTGCACTTCTCAAAATTGGCACTTCGGTCTTCACGATCTCCAAGGTGTCGCTGGACACGCTCGAGGTAGCCGACGGGATC
GCCAGTGGCGATGTTGAATGGCTGCTGTCAGCAGTGGAGGCGTTTATTGACGAAGTCATCTTTCCCATTCTCGGGCTCAGCCCTGCCCAGCTAAGTCGAG
CAAATACACTCTCTCACGTCTAAAGTGCTACTGGTGGACGTAGAGAGTATACCAAACGTCAAGCATCAACCCCCGACGATCAAGACTGAGTGACACATCG
CGGGAGCTGGGGAAAGGCGTTTGTTGTTGACATGCAAGGCGGATCACACGAAGATAAAGCGAAGGAGCTACATATCTACAGCGCTGAATGATCAGACCGG
AATGTGTAA