Description :
From Genome Similarity Track
Location :
Scaffold_308:24322- 30205
Transcript NameFunction/comments
Phymu_g8390hypothetical protein

Sequence
5883 bases(100 bases per row)
GATCGCTGCACAGATTCGAGGGCCTTGAGAATCAACTCCAGCGAACAAACGGAGCCAGCGCGCCGAACAACCAACTgcgccactgcagcagccttcCTTG
TGACGATCAGGTCAGTAGTTGAGCCAGCAATTGCAGTCTGTAGAGATCCGAACGCGTTTGCAGCTTGCAGTGCCGTTGCGTGCTGCTGAgtggcgtccag
ctcgcccCAAATGTTGTCTTGCAGCGTTTCTTCAAACAAACCAATGAGTGGCAGCAACAAAGTTGACGAGGCTGTACGCTTCGACCCCAACGACTTGCTG
GAAGAAGACACCGCTCCGTACCGCGAGAACTGCGAAGCCAACCATTCCACCAACGCTGTTTTGGTCACGAGATAGACACTTCCTGAAGGCGTTCGcaaag
cagcaagaagaatGCTCGTAATAAGGGGCTGCGTGTGCGTATCAGCCAGTTCGGACGTAAAGAAACTCAACAGCATCGGGAGTACGTGGCGTCgtacaag
cagcgcaacgtcATCATCGCCACGAACTCCACGTCGGAGCATGTGGAGAAGCCACGAACGTTCTTGGCGGAACGTCAGAGGCGTCCGACTGTTAAACAGC
GAGTAGAACATCGGCACATCGGCCAGATCCATGGCTGGGCGAGCCAACAGGAAGTGATTCACTTGCTGGTACAACACGTGCGTCGGTCGAGTTAACACAG
CAAGCGCGTCATTGAGGAACACAGTGACAACGGACGGAACCTGCTCGAGCGGCTCCTGGACCCCATGGCGGAATACGTCCAGCAAAAGATGCACTTGTCT
CCCCGCTTTAAAGTCGCTTGTCGTTTCCGTTGTAGCCTGTAGAGTCTCATGAAGGTGCGCGAGGACACCGAACGCGTATTCacgcatcttctccacgtca
gAAGACGTAGCTCGAATAGCCACGCCCAATAACCCTTGAAGCACGATGTCACCGTCCGGCAAgtccgacgacgagatgaagTGTGAAAGCATCGGTAAGA
GAAACGCTGGATCGTAGGCTTCAGTttgctcttcatcgtcaccacTTGGCAGGTCCGTATCAAGTTCCAAAAGGGAGGAATCGCCTGCGGTTGAAACCTC
GCGTTCTAACGGGAAGTGTTCGACGGTGGCACGAATCCGATTTTGCTCGAGACCTCCACCCAGCACCCAGGCGGAATCGTCAACCAGATCATTGTGGGAG
CGCTTCGATGGCAAATCCGCTGTGGATGATGCGCCGAAGCGGAAGCCCATACTTACCAGAGTTAGCTCTTCCTTTTGGGCCTCGAATTCGGCAAACAAAG
CCCGCAAACTGCGATCAAACGGAGAGAGCGACATCGAGTAcgagctcagcagcttctgcaagaGCGAGCGCGTGTAGTTCTCAGTGATACGAGCGAGTCG
TGCTACAACGCGCACAAGAAGTAGCCGCACAGCGCCGTTTTCCGTCTTCTGGAGGATCAGAGCAAAGCACGAGTGCAGCACTACAGCGCCGAAATGCGCT
TTAAAGTCGAAGTCGATGCCACTTAAGTCGTTACCCACAAGACGCAGTAAAACTGCTGTCAACTTGATAAAACCCTCGAACACAAACTCGTTGGCACTTT
CTTGGACGACTTCACGCATTTCTCCAAGTAGCGGAAGGACCATCTTCAACGCGACAAGCTGCTTTTCTTTGGACTGGTTCTTTAGAGATCTAACAACACG
TTCGATCATCAGTATTGCCGCTTCATTTTCGCTCGGTAAATGCTTCTCCACGTCATTTTGCGCTGCCTTCAGAGCTGCCAGGCTGCTCCGAACGAGAACA
AGCAGTAGACTCACGTCCACATCATCGTTACTGCCACTGTtgcgcaacaacaacagtaATCCAAGCAGTTGTGTAGAAGAAAGACGCTCCTCGCCTTCCA
GTCGTGCTAGTTTCCTCACAACATCGCCAGCAGAACCAGCCAGAGTGTTGGGGTTCGAGCCAGAATCGACTGATACGTGTTTCAACAGTGCAAGTTCTGC
TGCGTAGCTTCCCTCGGAGCCcaacagcacgcgcttgttgCAGACGGGGACCAATTGCTCCACAAATTGGTGTAGATTTTCGCTTACAATTCGTGTAAAC
ACGTTGTAAATCGCCCCTACAAGCTCACACTTGACACGATCATCCTGCTCTCGGTGAAGTCGTTTCAGCAGCTGCTCTTGAAACACCAAGGGAAAATCTG
CAGCCTCGTTCCCGCATCGAATTGCTGCGACAATAGCTCGCAGCACATCGGTGCAGTGCGCTTTTGAATCCGTTTGGGCACTACGCACCACAAGCGGCAC
TAGAGAGCTTCCAATAGACGCAACAGCACTGGACGCTTCAATTCCACCCAAACATCCAAGCACCGTGAATCCAGTCGTGAAAAATGACACCTGTCGCTTG
TTTTGgctgttcagcagctgcCAGAGCTTGcgcgcgagcagcttcgcgcGTTTATAGTCCGCGAAAGAGTCGAATTGCTTGCCAGTATCTACCAGAGAAT
CAAGAACACGCTCGATGAGCACCACATGAGGGGCGTTGATAGTCGTCGTGCTGAAATGGCGCAACAAACTGTCGAGCATTGGGATACGGGAGCTTGCAGG
AGCGTGCGAGGCTAACACCGCTATGGTCGGCACGCCAGCGCGTTGAAACAGGCCACCAAAGTCACACAGGGACGATAAATCCGTATCTGGGTTGTTGCTC
GAATAAATTCGGAGAGAAACGATCTCCACAGCTGAAAGTTGCCGCCACAAGAGAGAGTTCGAAACACTGTCCACCACTGCtcgcagcttggagaagatAC
GCGCCACTACATTGAAGGGCGGGGCATCCTCGCCAGAAACGATAACGATCGTCAGTAGATAGAGAAGCAGTTCACACAGCTGCGTAGATCCACTTGTCGA
GAACTTGGAATGGTTAGAAAGGAAGAACAGCAATTGCTCACACATACGCGCCGAGTCTGTCGCTGAAATCTGACGGTTCTTGGCAAAACGCGCCATCGAA
GCAATTGCTGACTCCTGCTCTTGAGAATTTGTGCTCGTGATACTGAAAAGAACATGTTGAAGGACAACAGGTACTGGGATCGTCTTCGAGAAAGTCTCTA
CAGCAATCGACTGCTTTTTTTTGCTCGTCAGTAGGGAGAAGATGTCCACGTCTCCCCGCGCCGACAGGTAATGGAGCACCGGACCGAAAGATTCGTCTAC
ATCTGCGCAGTTACTGACAATCTTCTCCCAGGAGGAAGTCAACTCCGCAGATGTCATTGTCACCAACGCAGCAGTGAGAGCATCCGGGTCGCTAAAGCGG
TGCCAGTTGCTGCTAGATGCCcgcgctttcttcttcgcggtAACAATGTTCTTAGACGCTGGCTTTCCGGAAGCAAGTGCATCGCAGTGAGCCTTAAGCC
AAACGTAAGCATCTTTACGACCAGACTCATCAGAGCCCACCGACCGCTTCCTCTTTTTGCTGTTGACATCATCACTGCCATCTTCTTGCTTCGTAGACAC
ATCCATAACCGTAAAAGCATCGTTGCTCGCAATCAAAGCGACCAGTTGCTGCGGGTGTCTACTGGTTGGCATGAGAGATAGCAAGATCCGCACAGCAAAC
GCTACCACACACGGGTCGTCACGGTACAAGGACAGATCCGTCGTCCCAATCACTCCACGCGAATTCAGAAATCCCACAAGAGCCACAGTAATTGAACTCA
gagaggacgacgaggacgagtcAACTACGCGGCTACCAACCGCAACATACACGAGAGGATCCGCCATCACAGCACGCGCGAGCTGTTCCGTGAACTCAGC
ACAAGTTTTGCTTCCACCATGGCGTAAGCTCTCGAGCCAGAACGTaacttcttcacttgcacGTCCACCACTGCGGGTTTCCTGTCCGAAGATGTCCGAA
GCGAGTAAAGCACGCTGAAGCACCTGCCCTGCCAGTCCCTGCACAGTATCGCTCGTTGAGACgtacaacagcagcatctgctgcagcttcgatcgGTCGC
CAGAGCTTCGACTAGTGAAGAGGAAACGCAGACGAGGAGTGTCCACAGCAAGCAGAAAACGCAGCATTTCACCAATGATCAAGCTTCGCATAGGTACCGG
CAAgacatcttcatcaccgTCCAAGTAACGCCAAGTAAGAGTCTTGGTAAAATCAACCTTCACCTCACGCATCGTCTGCGGAAGACACTCCAGATACAGG
CGGAAGACGGTAAGTGCACGCACGTAAATGAGCGCCACGCTCCGCTCCTGGGAAGCACACAACTTGAGTAGTAGTGAGACGAGCGCTTCCGGACTCGGGA
GCAAGAACCGCAGCTCTGACTGCACTTCAGAAGCCAGACCTAACGATTCCAAAGCCGAAGCTAGACACCTGtagcgcttcagcgtcgcctCAATCACGCC
TAAGGACGAGTAGATGACcaggttgttgctgtgctgGATACAACGCGAGAGCTCCTTGCGGTAGTTGCCGGGTGCGATTAGTCTCGACGCCAGAGACTGA
GCAGAGCACCACGACGAGGAATCCCCGCTTTTGGCCGTGGACAGGCCCGTCATTACAGCATCCAGAGAGCAGGACAGCAACCTCTGCACCAACGACGCCA
CACAGAACCAGCGGTAGACTGGCTTAGGCTCCAGCTGAACCGACAACGCAGCGAGATATTCCGACAGAAATCCCGGATACTTTACGAGAAACTGCATCAC
GAGTGTCTGCGCTTGACTGCTGTACAGTAGCTCATTCACGCCGATCGTACCCACCGCGTTTCGGATCACCTTGAGTGCGTAGGCCTGTTCCGACGACGTC
ACTTCCTCATTTCCCTGTGGATTCGCCGCCGACTTGGCCAGAAAGAGCCTCAGCGCCTGCGTCTCAGGCACCACATACAGCGCACTGTCGTCAAAGAACA
GTGCGTTGAGTACACCCAGTGCTGTGTCGCGTAcgctctcgtcgtcttccacttggagcagcgccagcagttGATGTACACACGTGGCGTTGAACACCAC
GAGCTTGTTCTTGTGCTCCACCTCTTCATTatgcagcacgagctccCCCAATCTGCTGAAAATTGTTGTCAAGACTTCAGCTGAATCTCCATCCATGCTT
TTAAACAGCGAGGCTGTAAGTCCTCCTTCTTTCATGGCAAAACGATGGACACTTTTATCCGAACAAGCTGTGAGTGCCAGTACCAGGTCCACGTAGGCTG
TTCTCAGTTGGAATGGAGCTTGTTTCacctcttcttggccgtcttcaacttccacaGGCTCCGCTTTCTTCCACCGTCTCGTAGCGAGCTTGACAAAAGC
TCCGCTCTGGAAATTAAACAGTCTCACGAGCTCCctcgctgcagttccagcgACTTTTGCTACTGTtgcaagaagctccagcgctcgaTACTCGATTAGT
GGCTTGTCACTCCAGCTCagaaccttctccagttgcgACGTCTTCTCTCGAATAATTCGGAGCGCAAACGCTTCAGCTTGGGCGGCATCTCGACTCTGTT
GGGCCTGCAATAGGTGGTTTGCCACATGCAAAAAGGTCGCGAAACTCTCACGCTTTTCCCAGCGACTGTTAGCACCGTGCTGGTCAGGCCAGATGCGTAG
CAGCAGTTCTCCTTGCGGGTGGATGGACAGGAATTTGCTACACAGAGCGGAGGCGTCTGTGGACGTCAACTGCGCGCTGTCAGCCAATTGGTCAGGTAGA
GAGAGCTGCAAGGCACGCGCGAAGGACACGATGGCATCGTCCAGGGGCTGGCGGTCGCGCTCCGCCgctagcagcagctcccgcaGTGCCTCCATGATGA
CCAATTGGTGTCTGTTTGTCGGTTGGCTCTGAAGGAGTGTATACTCGTGTATACAATTTGATACATGGGTACGTTGTGTGGAC