Description :
From Genome Similarity Track
Location :
scaffold_39:24321- 26643
Sequence
2322 bases(100 bases per row)
GTTtgcactatacttgtgcaagtatttgGGCAGTCCGAGCAACACCATCAAGTCTTTTTGAACGGAGACATTTGCCAATCTTAAGTGATCCTAACCGTTG
CGGAAGTCGCCAACAGGCCTTGCTATCTAATAAAGcaacaaaaaataattttgtcGGCCCCAAAGACATACTTGCGAACATCTCATTTGAGCACATACAC
TCGACCACCACTCGCAAGTGATTTATGTAGTTCTCCACATCTGACTTCCCGTGATCTGCACGACAATGGGCGCGTGTATCGAtgaaaaaaagttttgtAT
AGCCATGATATAGCCTGAACAGCTGTCTCACTAGACGACTGAGCGTTCCTGAAGCATTCAACTGTCACTATAGCATGACGAgtcactctcagagcatccc
gctcggagtacccACACAGTTAATGCATTTATCTCTCGCACCAGCAAATGATTATAACCATCAAGCAGGTGGTGGGCACGGAACAAAGTGCAGTCAATCT
TGTGGTTTTGTAGCACTTCTACTCGTGAGGTATACTGTTCAGCCAGAATAATGGCTAGATTATGCTCATTATATGTTTGCTAATTGTCGATAGCCTTTCG
GACACATAATGTCGGCGCCGTACCAAGATCGTGACGTGCTTTACACTGCAGgagacgtcaatgacgtaaCACCGTTCCCTTCGAAAGCAAGTAAAGCTAT
TTTGCTCCAGGATCCAGGTCAATTTCTTGACGCGCTCCCTATGTGAGGGTAATACGGGTGATGAACTTCTCATCATCACGTCAAGATATCCCTACAGCTA
AGGATGAAATTGATTGCATTTTTTACTGAGGAAAGCTCGTACTCAGGGCTCCGTAAGTGGCATTGATGAAATATTCATTTATGATGGACGACGAGCTCAG
CTACACCTTCGGTATCAACCATACCATTTCGGTAAGATTTCTTCCGCTCTGGAAACTCTTGCACATATTCCTGAGAAAAATACATTTTCCAGTTTATCGA
AAGCTTCTTCCAAAGCTAATGAGGGGAGTGCTTTAACCCCTAGATTTACCCAGATCACCCCATTCACGAGCGAATAAGTCTGCCGGCTACTTACCGGTGA
AGCACTGTCAATCTGCATGATGACCCACCacacggtagtgctgactcagcagtagcATCACGTCATGTAAAGAAATGGTCATATGTCTGAAATGCAGATT
CTTGACCTTTTACTCGCGACTCGTAGTCGCCTTCAGCTTCACCCGCTCTGGAGCTGGAGATTGCGACATCCAGTCTTTTTCAACTCTGGTCTAGGTGGCA
TTAGCTCCCAGCTATGCTCGACCGTCCCACTAGAGAGCACTCTGGGTCCTTAACATACAGTCGTCTTTTCCTGACTCGACGCAGCTACACTCTGGAGACC
GTGATATACAATCGATTTCTCCGTCTCATCCTGGGACCTCAACGCATTTACCTTTTTGCCGTTTGACCTCTGCTCGAGGCAACTCGCAATATTATTGTTA
TCAATTATGGATATCCACATGGCCTTCACGAATGCTATCTCAATTtcgtgcccgcgccaaaagaTGCTCTGATTCTGTCAAATGTGAttttatgactcac
caaaactTCATCAGAAAGAAACATCTAGCATTTACGTGGCGTCCCAGCCacgccatcaagattgtattTCGAGTTGAGGTCCAGTATTAGACAAGGTTTT
CTCACACTTTGAAGTCTCCAGATTTTACTTTCAGTCGCTAAAAACCTTAAACATTTCTACCCACATCTTTGTCGCAAAAATGGCTGCTCGTGCCGTCTAT
CATTTCGGCAGTCACGTGTCGCTCTTAATTGTACGACGCTCCTGAAGTATTACTTTAAGCAGGTTCACAAATCCCGAGACGTTAATATCAAGAACAAACA
AGTCAGGTCTGTCAGCCCCACCTCTATCAGAATGAGTCACTCTTTTGAAGGCTGGTCTCATTGACCACATTTTCcaaagagaaaaaatgaACCCACGTTT
TTCCCAGCAGCCAGCCCTGTACCTGCTGAGGCTCGACGTTTCCCCGAGCGAGTTTTGTTTGATGCTTTTGCATGGGAGCCTGACCCTTTCACTTCTAGGC
GAGAGCGAAGGGTGTGCAAAAGGTGCAGATGCATTCTCACAGATGAAAATCTGGAAGTGTCGCTAATTGCTCgtcgtcctcagcatggctgaATACCATC
ACATCTAGCGCACTCATTGAGCCTCTGTTTTCAGTACTCCACCCGGCCCTCGCGGAGCTTATGTTGTACTCCACATGAAATGTGACGGCTGCCGCCTTCA
TAAAAGCGGTGGTAGTTTTTGA