Description :
From Genome Similarity Track
Location :
contig_134:24321- 26056
Transcript NameFunction/comments
g14188.t1hypothetical protein

Sequence
1735 bases(100 bases per row)
GTGTGGCCCTACCGACACCGCAGCGACAACAATATGGTCAGCACATTGGCCAACATGGCAATGGAAGGTGCTATGAGCACACAACTAACGATCAAGGGAC
GGCCAGAGATGATCAAGAAATATGCAGGGGTACTTCGTCATATGGGCGAAGACATGACAGGGTGAATGGACAACCGATAAGGTCGCCGGCACGAAGCGGG
GAAGCGAAAGCTTGGATCGCACGGAAAACGGCTAGCAATCGACATAAGGGCGGTAGCTAGGACGGGCATAGGAAGTCATTTGTTTAACTAAGTGACATCA
ATGTACCTCACTGAAAACAAACAAAACGACAACAACAAACAGGTGCTAGAGGTGTCATCATCACCAGCGCATCAAGCAGCAGACCCACAGCCACTCAACT
GGAGGTTGCAGCCGCACCCGAACGCGATCCGAAATCAGATCTTGCTGTACGTTTCCGAGGAATTCCTAAGCCCGGGACACGACTTCATAGTGATCTCACG
CGGTTATTACTGCACGACGCCGCACAACTATCAACTGTGGTTATTTGTTCAACTGCTTCCTCATCCGGACTGTTGGTATCTCTCCGACGAAGAGTTTGAC
AACGGCCACTTTACGCGTATTGCAAGCGGTGCAACATGACGATTGCTTTCGTGATTCGGAACTATAAAGTGCCGGACCACATGAATAATTTTCACACTAC
TTGTGCTCTACTCGTCTTCGGTCATTATTGCCATCAAACCCGCCTTGATAGTAAGTCGTGCCGATGTCGAGCAATATGATCCGCTTCGAACAATCACTGC
GTTCGCATCCATACGCTGCGGTTGTGAGCTCGCCTGTTTCGGTTGCTTTCGTCATACATTCCTGTGCGTTGAGATCATCTGTAGCACCCATAGGCAAGAC
ATGCTTGGGGTTCCTTGATCGATTACGACGGTGTGAGTGTGTTGATTCACGTTAGAAAATGCAGGAAGGCGATACCTTGGCTATGGCGGAGAAATACTTG
GTCAATACGTGAAGCAAAAGTGCCGCCCGCAACGAAGTTGAAGGTCGCTTCACTACGCATTTTCAAACTCGTCGCTCTCGTCGGTACGATAGTTCTCCTG
CACCTTGGAGCAGGGCTGCATGAAGGGGTGCATGTCGTGGAGGAACTTCCTCTAGCAAGTCTGGAGGTTGTACGGTACGGTAGTTGAGCCGCTGAAGGCC
ACCGTCTGTACCACCACCTTGTCACTGTACTGCAGCGCCTTCATCACCTAGGGCAGCTCGTTGGTTTGCTTGACATCGTCCTTGGTCTTGGCCTCCAGCA
GCTTGACATCCGCCACTTGTGTGCGTCGATACAATTTTATACTTGGCTTTTGTATGTTAATAATGTGTGGGCCACAGAGATAGAGGTTAAGCCAGAGGTA
GAGGTAGAGGTGAGGTAGAGGTGGGGTGAGGTTAGTTAAGCTTAGTTAGCCAACCACGACAGCTCTATCGTTCACGACCCTGTCATCACGCACTGGCGAT
TGGGTTGACTTTGATATCATTTGCTGGTGGGGGTGCCGCACAAAACTGCCATAAGGGTGTCATAAGCAAGCTCTAAATGTGTATCTAAACATAACAGCTT
CACACGTACTACATGTATAAGTGATAGGTTTCGTGATATACGCCGAAGATTATGGTGGTTGCTTGTTGAGGGTAGGATCGCGACCTTTGGTATATCTACA
TACTGAAATGAAGATAAAATGTATGTAGTTGCCAA