Description :
From Genome Similarity Track
Location :
Scaffold_72:24321- 25684
Transcript NameFunction/comments
Phyci_232203ATP-binding Cassette (ABC) Superfamily

Sequence
1363 bases(100 bases per row)
atctgtctgctcacagtagccggtgcagcgacgcacagccagttcggtagcatccactccattcagcagcacacgacctcgaagacatggagcaccggtc
ttcttattgcctccttttccactcttgcgcccagccaacacgtccatcagagtcgtcttacctgccccagtagaccccatcagtgcagtcattgtgccgg
gcaacgcgtagcctgtgacgcctttcagcagctcTCTGGTGACCATTTCCTTGCTTCTACCTGGTTTGGATCGGGAATCCACCGACACGGGACGACCAGG
AGCTCCCTCGACACCATGTTGATCTTGTCCGGTAGGGTCCGGAACAACATCAGCAGGGACAGTGATGCTGTACCGCAAGTCTTGGAAGGCGAGAGTGACA
GCAGGAACTTCCCATCGAGGCATCATGCGTACGAGTATGTCGCCGGGGTCGGTACGCACACCTTGTGAGGCGTTGAACGATTCACCCGAATCTCCATTTT
CGCCCAGGACACCGGCACTAGGCGGCAGAAAATCAGACAAATCGCTCTCAAGCAAGTCGTCGTCCTCTCCGTGGGGTGTTGACAGCATTGCGTACGATTC
CTTTGGTTGTCTCGGTGTCGGGATGGTATCCGAATACGAAGCTGGTAGTGGAGGGGGTAGCGCAGGAGAAGAttcgtgacgacggtattccagcatcgcg
tacgacaggatcatgctgccaacgtacacagtcaggaggaaaacaatccccaacataatccatttggggtccgatggcacgtcgtagagtccgagagagt
actcgcccaaggtctgaccctggtacatcgtgcagtagtcgattcccccgtacacgcagacgtcgagctcaccgctgcgatactggcttaccaggattcc
gcgcgttgcccaagcgagaggattgctccagtagatccaccgcatagccgacggtagctgctctcgagagacagcaaagcccgcgaacaggatggagaac
agcaacgccaatgttgacgccggttgagccacgtgcagagtcgagcacgcagcagccaggaagaaatactcgccgatgaataccaagattgtcagtagca
tgtagagcacaaacaccaggaagtgctcgacggacgagacgaacccgcccatccagtagacaatagcgctgaagaggaatgcttcagtgatcgcgagcgg
tagctgactagcgcaggaagctaacacgtagctggacgtgcgatagaagttcgccccgcgatgcttgtagaagacctcgcgcgcgtcgaagaacgctgcc
aaagtcgccgattgaccaagtccgaggaagagtgcgcacgagaacaccacgcccagcgtcact