Description :
From Genome Similarity Track
Location :
Scaffold_3:2432056- 2433163
Transcript NameFunction/comments
Phyin_T30-4PITG_02526Dynein heavy chain

Sequence
1107 bases(100 bases per row)
TCTTCTCAGCTTCACAGCCACATCGCTTCAGCACAACTCGGAGGTCGTCATCAAAGTTGTCCAGAGTGTAATTCGAGGTCAACTTGATCTGGAACACGGA
CATGCCGTTCATCCAGCTCACGAAACGGGACAACACCGTCTTTCCTGCGCCACTTTCTCCAACAAGCAGCAAGTGACCAAGCGGTTGACGAAGCACGCGA
TCAATGCGAAGAACATGGTCGATAACCGAGTCGAAAACCACAAGCTGGACGTTTAGCTCTTCTTCGTAGAAGACGCGCAAGCGAGCTTCAATGTGCTTGC
GAAGATCCGTCGTCGTGACTTCAGTGTAGTTCTTGGACAGCCACGTGCTGAACAGAATCGGGTGTTGGCCGCCGTACTCCACCACCTCCAAAGCAGTAGC
ACTTTGAGGGAAGTGGTTCCTCAACGTCTCCTTCACCATGTGGAAGCACCACTTCTGCTCATCAGACGTCACCAAGCGATCCATGAAAAGTCTTAGGGCT
TCGTGGAAGACCAGCTTGACGAGAGTCTCAATGTCGATTTCGTACTCCAGCGGCTCAATAGCTTCGTACAGCGCACGCATCCACCTCGAGAGCTCTCGAG
GACTGTAGATGTAGTGCGGCTGCATCTCCGCCGTGAACTTCTTCTGGTTGTTATCGTAGACGTCAACCATGGCATCAGTAAGCGGCTGCACGTACGACCG
CAGCGATGGCGTCAGCTTCAGTAAAGCACGGTTGAATGTTCCGTAAATCTGCTTCAGCGAAGGATACGACGGGAAATCGACCAGAAGCACAGGCGCGTGA
CGCAGTAGACGCAGAGAAATCGGTACACGGCCTGGATCCGTCGGCGGGTTACAGGCACCGACGAACTGAATGCGTTCCAACCGCACCCAAGTGTTCTTTC
CGCCCAGCCAAAAGCCTCCTTGCTCGATCAGCTGTCTCAAGAACGTAATCACGCGCTGTGTTCCATATTTGTCAGCCTCCGGGAGGTTGACCTCATCACA
GAACACGACGAGCCATTTCTCCGGTGCGTTAGGCGCTAACAACATTCCATTGGGTGTGCGCTTGTACTCGCAATACTGCGAGAACGTCTTCAAGATTAGA
TCGGGTG