Description :
From Genome Similarity Track
Location :
scaffold_357:24317- 28120
Transcript NameFunction/comments
Pl_105688phospholipid-transporting ATPase, putative

Sequence
3803 bases(100 bases per row)
GGTCGAGTTGCGCATTGCTGTCGAGATGGCGTCCGAGCGCGGTAACGAGTTCGAGGCGATGTACGACTCGGCTAATGTCGTCTCCTCGTCGCAGCTGAAA
GCGAACCCCGTGTTGCGACGGCCTGTTGTCGGTCTGAACATCTTAGTTGGGACTCGCTCCCACGTTGCATCCTCCGAGATGGATTCGCTAAATACACTGG
CCGAGTAGCTGTCGGTAACACCAGAGCTGACCGATGTAGTCGAGTGAGGCACAGATGTTCCTGTAGTACTTGGAACGCTCTTCATCGGTTGCTCGTATAG
TGTACCAGTAGCTGCAAAGCTCTGAGGGTGTTGAGCCTTGAGGATTTCGGCATCCGAATGACCAAAGTCACTTAGATAACCGGTCGTGTGGACATCGTCC
AGGGACATGGATAGTGTTTGCTCCTCCATATTATTGATGGTCAAGCGCCGCTGGTACCTGCGCTGCGAAGCTCCGCCCATCGATTCCTGAAGAAGCTGAG
CCAAATCCGGGTGGAACGTGCGCTGGTATAGGTTGTACGCGATATGGCGTCCGAGTGCCAGTGAACAACCCATGATCAGAACGAGGAAGTAGCCCCATGT
CTTGGCGGTAGGAGCAAACGCGCCGAATTCATCGTAGCCCACCTTGAAGGTTGCAAAGTATGGTGTCTCCGTTCCCAACGCAGCAAAAGCAAACCATGAC
ATGACACTGCCAAACCAGAGCGAGAACGATAGAACTGTCCAGCGGTCTGCGATCATCCAAATCTTGATGTTTACAATCAACACCGTCAACGAAAATGCAA
CCATGCCGAATTCGACACGCGATTCGCTGCCTGCCGCCTTCTCTGATGCGTTGAAGCCGTACGACATCACTATGAAAATGATCAGCGACTCGTAGAATGC
TGCAGCAATCCAGCGGCCGAAGGTGTACATGTTGAAGAAGAATCGATCAGGGCCACGACGATACAAATCCGGGTACTCAATACTGAATGGAGCAGGCAGA
TCTTTGTCCAGGACACCGACCACCACGATAGGCAGGCCTGTGAAGGCAATGTTGTAGAGCTGAACACCGATTTCCCAGTACATTTTGGAACCCGAAGCGC
CAGAAAGATAACCGTACCAGTACTGTGCCAGCACAAGCGTGATGTTTTTGTAGAACATGTAGAGCACCAGCTTGGAAATACGGATGTAGTTCCACCGTCC
ATGAACTAGAAGTAAGCGCTCGAGGAAGCGGAACTGCGCAATGGCGTAGTCACTCGAGTTCACAGCCTGCATGCCTTCCTGTCCGGAGATACCAACGCCG
ACATGGGCAGCCTGGATCATGGCGACATCGTTGGCACCATCACCAATAGCTAGTGTCCGGACTGTCTTGATGTTGTCCCTCACGAGCTTCACCATTTCGG
CCTTCTGGGCCGGAGACACACGGTTGCAAATAACAGCACGGCATAACTTGGCGAACGAAAGTAAGTGAGGCGCAGTTCCTGGCTGTAGCGCCATCTCTAG
AGCCTCACCGTCGATGATCAATGAGATTTCCTTTTCGGCTCCACCTGCCATACCCTTGGCATTTTCTGTGAATTCTCGAGCCGCAGCGTTTAGCTTGGCA
CGGATTGCTGCTTCATCCGGGCATGTTGTGGCATTAACAATCACTTGTTGAATGGTGTTGTCAAGCAGTGAGCAAGCGTACGAGATATTGATCGCAGTCT
CTTCCTTGTCACCCGTAAGCATCCAAACTTTGATTCCAGCTCGCGTCAAATTGGCCAGACATTGTGGAACGCCATCCTGCAGCTTGTCTTCGATGGCTGT
CGCGCCAATCAGTTCCAGACCCTCCTCGATCTCTTCCATCAGATCATCAATGGCATTCGGTTTGCCGTCTTTGCGGCGGTCGATCTCGGCCACATTACCC
TGTGCATCATCGAAGCGCATCTTCCACTGCTGGAACCAGCGCTCATCTAGCTTTTTCATCGCAAGTGCCAACGTACGCAAACCGTCATCAGCATATTTCT
CCATGTGGTCACGCGTAATATTCTTGAGCTTCATCATCGCTGGGTCATCCTTCAAGCGTTGATAAATCATCATGTCAGCTCCCTTCGTGTAAAGCAGCAA
TTCTCCGCTTGGCTTGCGCACCACAACAGACATACGCTTACGCGTACTGTTAAACTCGAGCACATCCAGTATCTCGTAGGTCACCCGCTGTCCCAGAACA
TTCACCATCGCCGTTCCTACACTACGACTTTCAAACTTAAAACCTGCAAATGCTGCACCAGCCACGAGAGCTTGCTCGTCTGGAGACGATGCTGATAAAC
GGACTTCACCCGATTCCAGCTTCTCCGGGATCACTGTGTGGCACACTGCGAGGTGCTCGAAGAACTGCATAATCTTCTCCTTTTGCTCCTCACCAGCACT
ACCCTTCATTCCGTCAAACAATGCCTTGTCCACAAAATTCACGAATGGAATCCTCTTGATGCTCGGGTCCAGCTTGGGTTCCGGTGGAATGGGTTTCCCA
GCACGAACCAACGCAGCGCGTCCAATTTCCGTGATGCCTGAACCATATGACGTGCCGTTGATAGAGCACTTGCGAAATTCCATAATGTTGCATGTCAGCG
TGCCTGTTTTGTCACTGAAAACGTAAGAGATCTGACCTAACTCCTCGTTAAGCTCCATCGTTCGCACAATAGCAGGCGTGTCCGTCTCGGCATGGTACAT
CTCAAGGTCCCATGACATGAATCGTGACTGCAGAAACTTGACACTCGTCATAGACACGTACAACGAGATTGGAATCACCTGGTAAAGTAGCAAAAAGTAG
TAAAACATCATCTGGATGAACGCCACGAAGCGCGTGCGATTCCTTTCCGTCTCAGTGAGCTGAATGTACCACGTGTTCCTCACGATATCGTACTGCCACG
TGATGTAGCAAGTAGCAGCCATAGCGCAAGCAACAAATAGACCCAAGCACAAAATGACAATCATGCGGTTGATGCTGAGCATGAGATCACTCCACTTCGA
CGGCGCTGCACTCGCACTCTGCATGATCTTGGTGTCGTTACCAGTATTGAGAACCAGCCCAAATACCCAGTCCGTATTTCGCAAGTTGCAGCCACGCAGT
AGCACGTTCTTGACCGACAGAGGCATGACTTCCACACCACATCCGTCACCAACCGTGACTTCCACTTTCCCTGCAAACTTGTTGATGTGCGGATTAGGCT
GCTCACACTTGATGACACCTCGCAGCAGCGCTAACTCGGCAGCATTTGACAACGAGCTCATAGTAGCCGCTACAGCCTGTCGCAGCTTGAGGTTTGTTTC
TCCATCCAAACTCTTGGTCTCAACGTAGCAAATGCCGCTGGGTGGTTCACCCACTGGCTCTGAGACTGCAAGCACGAGCACATCTGCAGGGATGACTTCT
CTGTTGCGAATCTGCAAAAAGTCTCCGACCTTGATATCTGCCCATTTCCTGTCAACAACCTCTCCGTCATGAATCACATGACACGTAGCTGAGTTCGCTT
CATTATCCGATTTGTGTCGTCGCAAGTCCTCCATGACAGCAAACACTGCGTCGATCGAAATGACGAAGAACAACACAGGAGCGTTGGTCGGATAGCCGTA
TGTGTTACTGATACTCGGGATACTCTGCAACACGCAGACCATGAGAAAGAAGAAATTAGCCACTTTCGTGAAACTCTCCTTCAAGAACTTGGGTAAGAAC
GTCATCATGGAATACTTGGACGTCACGACGATATTCGAGCACTTGTCAAAGACTGCATTGCCTGGTGCATAATTGAAATAAACTTCTCTCAAAGCACCTT
CCT