Description :
From Genome Similarity Track
Location :
Scaffold_395:24317- 25358
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_395-abinit-gene-0.26Chloride Channel (ClC) Family

Sequence
1041 bases(100 bases per row)
CATGACCTCCcACGACGGAATGTCATACGCTGCCTTTGGTAGCTTCTTCAACCGCGGCAAGTTGCTCGTACTGATAAGCATATCGTACACATTCTCGGTg
AaTCGCTTGGCCGTGAAATACGCTGCTAGAATAGCGATAGATACGGgAaGGTTGAGACCGTCCGAGTGGGAAATTTCCATGATGATGACAGCGGTGGAAA
TAGCGTGGGTCACACCTGACGAGAACGCCCCTGCGCCGATGATTGCGAACTCGAATGGCTCGTACTGCGTGTCGAGTAGCCCATACGCGTTGATTGCTTC
ACCAACGAGTCGACCAAAAATGCCTCCAATGACGAATGTCGGTGTGAATAAACCAGCAGGAACCGGCAAAAtGACGCTGACCAAAGTGAGCAAGtACTTC
AGTGGTAGGTAGGTGATGAGCGACCGCGACAGAAGCTTGCTGTCTTCATCGTCAACGTCAGCAGCTGCTCCAGAGTTTGACGTGGGTGAGAATGGCTTGG
TCTTGGagAAAaGCGCACCAAGAATGCGATGTGGtGAGCCATGGCGAATGAACCAAGCGCTGTCGCCGTAGAACTCCGTCACACACGAGACCAGTGTTAC
CAATCCGACCAAAAGTAGACGCTTGCTCAGCGCAGAGCACAGAATCCTCCGCACAGGTGAcGATGAGGCTTCTGTCGGAGTGTCGCGGAGGAACTTGTCA
CGGATTCTGACGAGAAGAGAGATGCAGAAGTTGAAAAAAGCCCCACcTAGACCACACGCGACCCCCATCAGTATGAAGATGGTAAGATCCCGCGTTGTGA
ACGCGTGCAAATCGCCAATCTCAGATATTCCCATGTTGGAGCTACCAAAGAGGCCGTAGCGAGTATTGGAGGTGACGAAATTGATAAGCAACGCACCCAC
AATGgCAGCGAAGAACGACCGAGGAAGcGTCCGCACCATGTAGAAATGAGATGTAACTTCGACACCGAAGAGAACTCCACCAAaCGGAGAGCCGAAAGTC
GCGGCAACTCCGGCTGAGCATGCACACGCgAGCATCTCGAG