Description :
From Genome Similarity Track
Location :
scaffold_436:24312- 25459
Transcript NameFunction/comments
Pl_104881hypothetical protein PHYSODRAFT_286623

Sequence
1147 bases(100 bases per row)
CATTGATGGCCAAGAACTCGCTGTGTAATGTGGTTCTACTTGAATTGCCAGTGCCGTTGAGAGCTGCCAGTTTGTCATCAATCTTCTGGGCAGTCACCAT
GTAATGACAGTAGTCGAAGTCCATAGCTGACCGCACTGGAATGAACCTGTCATTCTGGTCATTAAAGATACATAAAATAAGGGTCACTCAAAGTTACCAT
TACCGTCCGCAGTCCACAATTCTACTAACAAACCTGATAGATGCACTGTTGGCGTCGGCCTTTTGAAGACATTAAGTCTAAGCTGCAAGTTTCAAAGTGC
TGTGAGAATTTCTTCGGCAGTTTGTCAAGTGACAGATAGGTCTTGATCCCTTGGACGCAAGAACTGTAAAAACATATACTGAAACGACGCAACCGTGACA
ATTAATATCGCAAGTTGTTCACTGTCAATCATTCGGGCACGAACTTCGCATCTGGGTAATCCCTACTTACATCTTGCGCACTACAACGAGAGCTTATTAT
CAAGGTGCGTACCCTGCTGCCTGGCGATCAGCTTATGCTTGGGAAGTAGGGCTGACGAGCATGAACATTGATTTTGAAATGGAGCAGTCTGGCTGACCGT
TTCTACCAGGACTCGCTACTATAGGTGTAGACAGACAAGTAGACAAATCGACATAAGCGTGTTTATCATCGATTATGACCACAATAGCGAGTCTTGTGCT
TCCTAGATTTGAGCCGAGACCTTCGAGTTTCAATTTTAGGAAAGCTGATCACGGATTCTCGAAGCGCAGTCCGCGACCAAGCTGCTTGATACGCACGCAT
ACAAGGACATAAACTCTGTGACACAGCCAATTTTGTAGCTGTTCAAATCGATAGCACTTCAGCTTTCCGGCTCGTTATTGTTGATGACCTATGTCAGGTC
CCAGTGCTTTCGTCCCAGTGATGACTACCCAACATATCGCTGTTTTTAAGTCGCTACAGATCGTCGCCTCGCTCACGATTACGGCTTTGGGATTACGTAG
GGAGAGGCATCTTGATTAGTAAAGCACATAAAGTCCGAGCAACATGTAGTGCTGCTCGAGGACTCTCATTTCCAAACCTTCTCAGCTCTCCACAAGTACA
ACAACAAGTCCCACTCATGACTCGCATTGTCATCGTCGGAGGAGGCC