Description :
From Genome Similarity Track
Location :
Scaffold_1179:2431- 4784
Transcript NameFunction/comments
Physo_126524hypothetical protein
Physo_126525Pol

Sequence
2353 bases(100 bases per row)
GTTCCCCAACACCACCCAAATACCTCTTCGCCCTGGTAATCCTTCCAATTTCACAGAGTAAAAAGTTAGAGTCCAGCGCTGAATTGCGACGGCCTGTCTG
AAGGTTGAATTGCCAAGAAAACCGCGTAGCACTGGTCCAACCGAAACTCGCTTCTTTGGTTGCTGGACGTGAAGCCATTCCCCGGATGACTGCATGCGTC
TCGAAATCAGCTGCCTTCCACAAGATTCGCTTAGCTTCTTGTGGCGGTACTTGATCTCCGTCAAAGACTTCTCTATTTCGTATCAGCCAAAGCGTGCATT
GAGTACATGTCGTCCAAATCAGCCACAAAATCCTCATAGCTTCATCCTGCCCTTTCCCCCAGCACGAAATACTCTTCATGGCTTCGTCAAGAAACGTTGG
TGAAAGAAACCTCAGGCGGTCTTCTGGCTGCAAGATGCGGAACCAGTGATGCTAGCTCGTCTCGATGCGGGTAGTGTCCGATCCATTGGTATAATGTTGG
ACCACGAAGTGTTCGGAGTTGCTGAGTTGTATTGAGCAAAATACAGAATGAGCAAAAACTAAAGAAGCAAAGCAAAAGCTAAACGGAGACTTGGTCAAAA
GCTCCGCTCGTAAACATACAGATGGAGATTGTTACGCGGTGGGTCCGGTCACAGCGCCACCGAGTGCACGCCGCCAGATGCCCGCCATCAGTCACGTGAA
ATGCAACGCGCAACTTGTTTCCGCACTTAGTCTGCTCCTGGACTTGCGTCTGACCGTGCTGTTTCGAGACTGATCTCCTACTCACTCAATGCAGTGTGAC
TGCAGCAAGTCTGTCAGCCACTCATACTACTTCAACACCTGTCTGCTGCTCCGCAGCTTCTCCTGTCCTCGTCCCTCCTGCTTGGACTCACGCTCTTGTT
GTCGCTGCTAGCGACACCTCCGTTGCGCCAACGGCTGCAACCGGAGCCGATTCCTAACAGAGATCAGTGCGCACGCTGGGTAGCAGCCAGCACCGATGGC
AGGAACACGACTTGAAGTTGAGGATGCCATCGCGCAGCAACTGGGTTTTGAGAACATTACATCCTCCCCGAGTTTATCTGCGTCTGCGGGTCGGCGGAGC
ACGGCGCTGCTTATTCTTGAGATCCTTCAGCAGTGCGTCCCAGTGGCTGACATGGTTGATTTCATCTTCGAACTCCCAAGAGTTCTCGCTTTCAGGCAGA
TCCACCCATGAGCAGAGGTACTGCTTGCGTCCACCTTGGCGACGCTGGTCCAGTAGTGCTCGAATAACATACACTCTTTCGCCATCTTCGTCATACATGC
GAGGTGCGCTTTTCGTGATCTGGCGACCACGAAAAATCTCTGGGACGTTGACAGAAAGCTTGAGTTGATCCACGTTGAACGTAGCGTGACGTCCACGGGC
AAGGTAACGATGAGGCAGAGCGACACGGTATGCATTTTCACTGATGCGTTCCGCCACAGGAAACGGGCCGTACCACTTCGGCAGTAGCTTGTTGCAGGCA
GGGTCGCGCTCGGGGTCGTAATCCGGTTGGCCAAGCTCACTGCTTAGGACCTGAGCATCCACGTACACCAAATCACCTTCGTTGAACTGCACTTGCTATC
GCCCACGGTTGTAGTAGTGCGCCTGACGTTCTTGAGCTAGTCGCATGTTGCGCTGAGCCAACTCAATCACTTCCTGCCGGGATCGGATCATGTTCTGTGC
CAGGTTGCCAGAAGTTGCCAGAACTATCGGTGAGCGAGGTTTCCGTCCACAATCTACCTCGAACGGGGAAATGCGAGTTGAAGTCGACACCAACGTCGCA
TGCGCGTATTCCACAGTCGGCAGCATCTTCACCCAATTGTCACCATAATGAGAGACGACACACCGGAGACTGTCCTCCAACGTTCTAATCTGCCGTTCGC
TACGTCCGTCGGCTTGAGCTCGCTTCGACACAGTCATTCGTTGCTTCACCTACATGATCGTCATCAACTCACGCCAGAACTCGCTTGTAAACTTGGGGTC
TCTGTCGGAAACGGTGGAGTCAGGAAGAGAGTAGTAGCGCACAACGTGGTCGAAAAACAAACGAGCTGTAGTCTTGGCGTCGACATCTTTGGTAGTCGGA
ATGTAGCAAGGTCTGTTCGACAGCCGACACACGACCACATAGATTGCGTCAAACCCCTCACTCAGTGGCAGTGCCGTGACAAAGTCCATAGTCACGTGCT
GCCAACAGTGTTCAGGAACCGGAAGCGACTGCAGCAGACCTTTGCGCCGACGAGATCCAGACTTATGGCGCACACAAGCTTCGCAAGTTGAAATATGCTG
GGCAATATGCTCGCGCATGCCTGGCCACCAGAATTACTGACGCATCGCCACCA