Description :
From Genome Similarity Track
Location :
Scaffold_72:243041- 248308
Transcript NameFunction/comments
Hyaar_Emoy2808035Zinc phosphodiesterase ELAC protein 1
Hyaar_Emoy2808036predicted protein

Sequence
5267 bases(100 bases per row)
AGAGTCCAGGCACGGCAACAATGCTGCTGCCTACGACACTTTTGCACTCGTCTATGATAGTTTATTCGTGAGGTGGGCGGGGAATAGGAATGCGGAGGAA
GTCGGACGCAGGTATAACCGCTCGTCGACCAAACGATTCTTGGGCCTCTAACGCCAGATGAAGTGTTGATAATGCGGTATAGTCCTCCGACCAGTGCCGG
AACCGGTGGCTGAAATGCGTCAAAGCAAGTAATGTCGCGTTCATCTTTTTGGCCGCGTACCCTGCCATACGAGCTGTCGAGTGGCCACGATGCACCGCCT
ACAGAATCATCGACATGAGAGCAATTGAATAAAACAGCGAAATATCCTTGTAAGGCATCAGACTGTGCCCATACCTGCTTGACCATTCGATGACTCAGCG
TTGCTTCATGGATCAATACCTGTTGGAAGCATCCGACAGCACATCACGTTAGTAAGCTTTACATGATATATTACAAGACGTAGTGCTGGTGTCACTTACA
TCACAGTTCTGTGCTATATCAAACATTCTGGAAGAATCCGAAGAATCGCCAAGAATAGCCACCTTGCGTCCGCGAGCCTTTGGCCCGATTACCTGCAATG
CACGTCATCAGTCACCCTGCAAAAACCCGATTCGGCCGTAGTTATGCCTTTGGCAGACGATACTATCGACCAACCTCGGACGCATGAAGAGTTTCTCCAT
TCGGCAGTTCGACACTACCACCCAACTTTAGTGTACGGTACTGCGGTCCAGGTGGCAGACCTCGCTTACGAAGCGCATCGATGTCCAGTTTTCCGGGGAA
CGGGTATTCTTCCACGACGTAACTGTTGTGTCCACAGCATCAATGCCGTGTCAGCCACATTCCCGATTTCTTAATGACAATGATGCAAGAGCATACCCGA
AGCTCGTAACCGTATGCTTCAACGTAGCCGCTTGCACGACAAACTTTCCATCATCCAGCACATTCCATACATGACCGTTACCATCGGAATCAGCGTGGAT
CCACCTGCACTGAAGACTCTGCACGTCGCATTCCACCACACAAACAACTCATCATCCACATTCCACCGGACCCACTACAAATTCCCACACATTGACAGTC
TGCAAAAAAAGACATACAGGATGTCGTGGTGCGTTCCGCATGAACTTCTCATGTGCCGACATCTTCTTCAGCATAACGGGACACACCAACTCATGCACGG
TAACCCTGAGGTTCGTCAGTCTCGTGCTGCTCGTGGAAATGGCCGTATTCAAGTACGAAAACAGTCCGAGCGGTCCATAGACGTCAATAGGTCTCGGACA
CTTGGTTTTTGTATGTGGGTCTGTGTACTCGGCACTGTGGTTGTCCAGCGTACAGAGCATGCCTGGCAATCCATAGACGTGATCTCCGTGCAAATGCGTG
ACGAAAAACTTGGTCGTGTGCGGTACACACATAAAGCTCTTGATCATCTGCCTCAGACTGCCTTCCGCACAGTCAAACATCCAATTACTGCGCCCCAAGC
GCACACAAACACTCGTTGGATTGCGTCGCACAGCTGGTGAACCTGCGCCAGTGCCTAAGAACAGCACTTCAAAGCCAGTGAACGGCACCTGCTGCGGCGA
CATGAGCAGCGTCTTGTTGCAGCTCCGAAGAGGTGCAGTCTTGAGTACAGCATAGCGCTTGCTGATGCGCGCGAGAGGCACGGAAGACCGAGCCGCTTGA
GCCACTAGAAGCTGTGCCATGCCGCTTCGCTCGACTAAAAAATGACATCGAAGGTGATAGAAACGAGGATAGAAATTGACAATACAGTCCGACGATGGTG
TTATGTGTGTGTTTTGTTTCTGTCCTTTGGGTGTATAAAACCCAATCTAGCTTCAGGGTGGGTGGGTGTTTTTTGTAAAATGTCGTATCACCCATTAGAG
GTCGCTCGGTTTTATTGTTTAAGTTTTAATCATGAGCGACGACGCCATTGCCAGCGCGGACTCGACCAGTTGTGACGAGTTCGTGGACGGCGCAATCTTC
CGCGTGAAGCTGCACAACTTTCTCACGTACTCGGACGCCGAGTTTTTTCCAGGTCCTCGTCTGAATCTGATTCTTGGACCCAATGGCACCGGCAAGAGCT
CCATCGTCTGCGCGCTCTGTGTGGGACTTGCCGGCAGCACTCGCGTAGGTTTTATGTCGTTTTTTGGTGGTGGTTGGTCTGAAGTAACCCTTAAGTGTCA
ATAGGCTTTACAGTGTGATGAAAACAGTCTGTGACGTGATTCCACTCTGCTTTTCTTGTTGTTGCTGTAGCTCCTGGGACGTGCAGACAAAGTGGGGCAG
TTCGTGCGGCACGAGAATGAGAGCGGGTATACCGAGATTGAGCTCTTCTTTGCACACAAGAACAAGGTCATTCGTCGCAACATTTTTCGAGACAATAGGA
GCACGTGGCAAGTCGACGGCAAGGACTCGACGCTCCGGGACGTGACGAATATCATGGAGACGGCCAGTATTCAGATTGACAACTTGTGCCAGTTCCTGCC
GCAAGACAAAGTCGGCGAGTTTTCGAGGATGAACCCCGTGCAACTTTTGAAAGCCACGGAGAATGCGATTACAGACAGCGATTTGGCTGCCAAGCACGAG
GAGATTATTGAGCTCCAGCATAGTATGTCGGACAAAAGACGGGTGGGTAGTTTTTGCTGTGCAAAGCATGGATATGAGGCTGCAGCGATGCCTGATTTGT
GCCGTCTCGCTGTCTGTTTCTGTCGGTTGTCGATAGGAACTAGAACATGCGCGCGCGGCACTGGGGCTCAAGAAGAGTGAGAACGCGCAACGGCAGAACG
AGGTAGAACGGATTGATGACTATGAAGCCCGAATCGAGGAGGTGCTGTTTTATGATGCCGAAATATGTTTGTATCGCTGTGTTTCCTTGTGCTCTTTTTG
TTTACTGATGCTGTATGGGCTGGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN