Description :
From Genome Similarity Track
Location :
Scaffold_179:24302- 25739
Transcript NameFunction/comments
Albla_Nc14092250origin recognition complex subunit putative
Albla_Nc14092260

Sequence
1437 bases(100 bases per row)
GTTCTCGCGAGTATTGACCACATAAACAGCCCGAGCATGTGGCTTGAATCGGATTTAGAACGTTATCAATGGGTATACCATCAGCTCGATTCAGACTCAC
CATACGATCAGGAAATTGCATGGCAATCGTCCACGTCACAAAAAGAGACCAAGCAGTCTTTCACTGGTATTCGGTACATCTTACAAAGCCTTGCACCCAA
AGATGTTTCCATATTGCGATGCATTGCGCGAATTCAATGGGCAGCAGCTACAAGCACTACACGGAGCACACAAGTATTTGCGGAATATCACAAAGTCTAT
AAAGAAGCTGCAAAGGAATTGCTGGTGCGATCTTACGGGGCGTTCAATTCGTCCATCAAAACGCTGAAAGATCATGGTCTTGTGTGTCATCGTCAAATGC
GAGGCATTGAACAGCTAGATATTTCTTTTGATGATAAGCACGTGATTGAAGAGATTTTATGCTCTCCAGAAATAGGCAATACTTGTAAGGCAGATTAGCA
TTATACACCGCTTTTCGGCGCACTATCGCGATGTTCTGCTCGTCTGCAAATGGCAATGATCGAATATCAATGATTTGAGCTCCATCTTCTTCTAGCGGAG
ATCTAATATACTTTCCCCAAAGCCACTCAGAAAAATCCATATTGTAAGATCTGTCACCTTAATGGTAACAGAGTGCATTTGTATCATCTTTTGAGATAAT
TTATTGCGTATTATATTAGCGCCTTGACAATCTTGCAGCGGATGTGCTGGTCGTGGACAACGTCCTCGATAGTCCGTTGTCCAGGGGAGACAAAAACAGT
GAGCTTTTTGTGGCGAGAAATGTCAGTTCTCAAAATGTATTCCACCAAGCTGAGTCTCATTCACAACATGCTTTGCCCTACAAGCGCTCCGTGAATTTCC
ATCTGCCACTTTATCGAAACACGAATAAAAAAGTTTCTCCGAGTATGAATTTGCTTAGCATCGCACCACGCCACTTCAGATTGCTGCAAATCTACTCTTG
CCTGAGATAGTGATTGCATAATAATCCTTTGGTGAAGAATAGTGTTGATGTTGACTGTAGAATTCGACAGCTTTTTAACCAGTACCATCCTCCTTATATC
GCTAATTTGTTTCAGTTCCATCCAGCAAGATCTTCACAGAAATGGAGATTTCTGTCGAGAATCTTCTCTAGTTGGCATTCAGCTCCTGAAACACATGTCG
TATCACCCGTAGGTTTTCAACAGCTGTTCTGGTGACTTGGCATGTGTCCAGTAGCATCCACGCACCCGATAGCCCTGTTGATTTCGTACGGTGATCTTAA
TAATGAATTGGTTGTGCCCTATTGGTATGGCTTCAAGAAACTCCTCTTGAGATATCAGTCCCGGCCGAACACTCTAGATTTCCCGCATACAGATTAAAAA
AGAATCTAGCCTCGTGATCAGTAGCGTTGGTCTTAAG