Description :
From Genome Similarity Track
Location :
Scaffold_1798:243- 3333
Sequence
3090 bases(100 bases per row)
GTTCGTAATGTTCAGCCGTTCCATCCCTTCGTTCCGATGTCAAGACCAAGAGTTTCACTGCTTGCTCCGGGTCCAACCCTTTTCACTCAGGCTCAATCAA
AGAGCCGTCCGCCCCCCTGTCCTGTTGAAAGCCGGTCCGTTCCGTTGGACGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGG
ACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCC
TGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGAGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTA
CCAAATCCAGCGCACTGTACAGTACGCTCCCGACCATGTTGTTCAACAACACATCCTTTCGTGGGATCGGTGTTTGGACCGGCACCGTTGCGTTGTTCAG
CTTGCTATAAGCGTGAGCCAGACGCCAATTTCCGTTCGGCTTACGAACGCAATAAGTCGGCGTCGAGTGCGGGGATTTCGAATCCCGCACCATGCCTGCC
TTCGCTTTCGCGGCGAAGAAGGCATCGATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCACGAGATCAA
TCTCGTGCCGTACGCCTCGATCCGGTGGGAGTTGGGTCGGTGGGTGTTTGTTCACCACGTCCGAGTACTCCGTCACCAAAGGATACACCGGATCCTTGGG
GTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCATGTCTTCCAGGACGTTCTCGTCCAAGACAGAGGAGGAGTTCAGCTCCTCTTGA
GTGGTCTCAGGTCGCATGAGTACCATCTCAGCAATCTCTCCAGCCTTGAGGTTGGTCAGGAAAGACTCAGCCGTCATTTCCTCGAGGTGCAGTATCTCTG
CAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCAGTCTCGCCATCGAAGATGTGATAACACTCTTCCACCGGCCTTGTCGG
AGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGGCGTCTTTGCCGACGGCGT
CTGTGACGGGGAGCTTTGCTGCCCATGTCGTGGCCTCGTGTGGTACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTCCTCTTCAGTTAAGGTCTG
GGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTGTTCGACGCCTTCCTCTTCAGTTATGGTTTGGGCGACCGTGAGTGGAACTCTGTTACCC
CCTTTGAACACGCTGTTCTCAGTGTTCGTGGCAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTGGACCTATGCTACTCACTTGGCCGGAGCCTC
TTCTGGGCGCGGCCACCATGAAAACATCCTCGGAGTCGTCATATACGTCGACGACTCCCAAGCATCTGCCGGATGCTTTAATACCCTGGCAGCCCTCGCG
GGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTCTGTCGGACTGCGCAGGGCGGCTGGCGCCGATTGCCTTGCCTCGCCAGTCGATC
CAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCAAAAACAGTGAGCTGTTCGAGGCTGTCAAAGTCTTCAAACT
TGACGGCCAGATCCACTTGGACGTTGGGGACAGTGACGACCTTCCCGTCGGCCAGTCGTACTGATACCGTCCCCTTGCCCTTGCTTTCTCTCAAAGCATC
GGACAATTTGTTGCTACTACGAGCAACCGTCTGGCGTCGTGCGACATTCTTCGACGCCCCAGAATCGATCAAGAATATAAAGGGATGATCGTATCCCCAT
ACACATCCGAGTACTACGAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGC
ACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTCCCTGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGCCAGCGACCC
TTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCTATCTTCCCACAGCCGAAGCAGCGGATGTCAC
GCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTGGGGCTTGTTCGACCGGGAGCCGACGAGGAACTCCCAGGCCACGCTGAGGCCGGCGTACG
CGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTCTTCAAGGGTGCTTGCCTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACT
CGAAGGCCGTCCATGAACACAGTCATCTTGATGTGTTCATTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCA
GTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGTACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGCTGTTCGCACAGCTGAGC
CCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACTCTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACGCGCAGTTGC
TCGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTATACTTCTCGGACCCAGAAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTTACCTTCAGCC
GTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGTTCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATT
GACGCGCTTGAGCTGCTCAGCCGGTGTTGACACCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTC