Description :
From Genome Similarity Track
Location :
Scaffold_1233:243- 1481
Transcript NameFunction/comments
Phyta_totarag12477hypothetical protein PHYSODRAFT_326285

Sequence
1238 bases(100 bases per row)
TGTTGAGTGCGACCTTGGAGATACTGCAGCTGTATTGGCCATTGAAGTACATGTCGTGGCCAatattgttgctgctgctgttcaccAAAAGCGACGAGAT
CTGCACAACGGAGACGGCGGCCTGGTGCTTGGTTGCGAGCTTCAGGTTGGGCAGCAACGCATGTGTGACGAGGAACGGGCCCACAACGTTCTCCTCGAAC
ACCTTCACGATCATGTAATTCGTCGGCTCGAAGGCATCGGTGAACCAACCAATACCCGCATTGTTGATAAACAATGGCCACACCCTCGATATGaccagct
gcttcagtcACAGTCGCTTCGTCGCTGGTATCAATCGTGACGATCTTGAAAGGGGAGAATGCAGCGAGCTGTCAGGAAAATAGGGGAGCGTCAGTATAGG
AACAACAGAGGTTAAGCGGAAATGTACGCACCTTGTCGGAATTGGTGTTGGCACTTGGTGTAGTGAGTAACAAACGTAAAACCGATACCTCGCGTGCTTC
CCGTGATTAGGGCCGTATTTTAGGTGGTCGCCATGGTCGTAGTAAATCGGAGTGGTTGCTAGATAAGGAGCAAATTGAAAGTGAAAAAGGCCCTGCTCTA
CATGCTACATCGCCGAGAAGAGTGGGCACGGGCGCATCTAACGTTTTCTCGTGTCGATATGGATTCATCTAGGTAGTTTAtccaaatctgtccaaattgt
ccaaaacGTAATGACCGAATTATCAGAAAGAAGGATTCTTTAGTAGAAGTAGTAGTAAGTAAGTCCCTGGGTCGTCCAAATTTCTCCCAGTCTAGCGTCA
GAGTATATTAGACGCACACTCCATGTTTCAAGTGCTTGCAAATATGTCGTGGCAAGCAACTGAGGCGAacggttgcgagcgcgctGAGCAATAGCAAACC
CCCGCTGGGTGCCCACGAAACAggccgcgcggtatttgcgaaggcgggcccagcgccgagcattccagcgagccgagccTTACACTTACCTGGACATTCT
ATCTTTATATCTCGAACGAAGCTAGGCGCGGCGGCCCCTAAACGGCCCCCTGCCGCTCTACACTTGGCCGGTTACAAGTTGATATCGCCCAACCATTTGA
CTAGCTAATCCTCGAGTTAGCTCAATGTAACCTAAACTTTAGCTAAATGTAGCCTACATTTATTTGGTAATTTATCTGAAGTCGGTAACTTTGGGCAGAT
TTTGGACAAACCCGGTCAACTAACCACTCAAGTGCAAT