Description :
From Genome Similarity Track
Location :
Scaffold_31:242946- 247357
Transcript NameFunction/comments
Phyci_6132Hypothetical protein
Phyci_92290Hypothetical protein
Phyci_221299hypothetical protein

Sequence
4411 bases(100 bases per row)
aacatgcttctcccctcatgagacttatcataggtgctccagtagcgttcagagacgaaaaagcacttgcagattcatctcgagggcaaagaccattagc
cagtagaatgaacgtgcggtccgcggcttcggggaccatcgagctggacacatcgtgcatcttcagcgccgccacaacaccattcactgcgatttccccc
ttcaaatagctagccgcagtcttcgacacagacgacgtaaatgccacaacgaacgtatcgttttccccgcaattagcagccatccggtcttccatgtcga
ccgcagacagcgccgatttcgagtccggccacgacgaattccactccgccaccatagcgCACACCGACAATCGCACCGACGAATTAAGCGTACGATTCAC
AGCTTGAAATCTCGCCCAGTACGATTCAAACTTGCCGCTCTGCGTTCCTTCTTCGAGCAGCGACCAGCTCGCAGCCTGGTATAGGACTGTGCTCTCTGCG
GCGGTGGCATAGCCAGCGACGCCATCAATCCAAGAGCTCGAGATGGACATGTTCGCCACCAGCACGAAATCGATAGGTTCGTCGTGCTCGGAGGAGAGGT
CTCCTTTACCCACGAAAGACGAGGTCGCGTTGTCTTCTTGGTCTTGGCCGTCGGAGATGGAGACGACGGTGCCAATGCTGATAGCCCCGGGCGGCCCGTT
GCTGGGGCCGCTGCAGCTTGCTGACGAGTCTGCATAGCAGCTCATAGTTGCCAGCGCAAGCAGCAGCAAGCCTGATAGTGTCTTCATCTTCGGCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNtggcactgccttca
ctcgtgatctgagacggcccgaatcctccactaggtttgcacacggttcccctgaaaaggcttgccactgggattccagccacagccaaagagtttaatc
cgttggcggactcatctcgggggcaaagaccattagctagacgaacgaacatgcggtctgtggcattcggaaccatcgagctgtccacatcgtgcatctt
cagcgcagccacgacgtcattcaccgcgatttcccccttcagataactagccgcggtctttgacacggacgacgtaaatgccaccgcgatcgtatcgttt
tccccgcacttggtcgccattcgatcctctaggttgaccgcaaccaacgccgattttgtgtccgaccacgacgaattccactccgctaccatagcgCACA
CCGATAACCGCACAGACGACTTGATCGTGGGGTTCACGGACTGGAACCTCGCCCAGTACGACTCAAACTTGCCGCTCTGTGTTCCTTCGTCGAGAAGCGA
CCAGCTCGCAGCCTGGTACAGCACTCTGCTCTCCGCAGCGTTGGCGTAGCCAGCGACACCGTCGGCCCACGAACTTGATACGGACATGTTGGCTACCAAG
ACCAAATCGATGGGCTCCTCGTGGTCTCCACCAACGGAAGACGAGGTTGCGTTATCTTGGTCGTGAGCATCGGAGGCGGAGACGACGGTCGCGATATTGA
TCCCGTGCACAGGATTATAGGACCCGCTGAAGCTCGGCGACCCGGTAGCGACGTGGCTTGCAGCCGCGAGCGCGAGTAGTGCCGGTAGCAAGCACGAAGT
AGACCTCATAGCTCCAGGACGAGCCGCTCGCTTTGACTGGTGAAGAAGCAGAAGTGATGCGCTTATTGCCACGAGTCTTGGAGGGGAGAAAAGTGCACGG
AGTTCACTGCTGGTCCCAGCTGTGGTGCCTGGAGGCATTGCTAACGCTTCGTTGCGCGGGCTCTTCCAACGGTCCCATTAACAAGCGTGAAACATGACTG
AAGCTGAGTTTGCTGTGACCCACGAACAGCAAACGTGTACGCTACGAACCGGAAGACAAGTGTAACGATGGATTCCGGTTAGAGCGAGCAAAGTAGCCGG
TAGAAGAAGCTTACAAGCTCCTTCATCGGATTGATAGAGCAATACACTACAGCTAAAGTCGCACGGGAAGAGAGTCCGAGGCGACGACTGCTGTCTTACA
TGTTGCTATGGTCTACCTGCTCCAGCACAGCATTGATGGTATCCACCGAGTGCTTCCACACGATCTCCTTCATCTCGTCGGTTTGGAACTTGGTCGGCTG
CAGGGGCTCTGCGTTCCTGTTGACCAGGTGCCAACCCGCGCTGAACTCGTCATTGGTTAGCGCCATCACCATGAACCTCGCGCAGTCCTCCGGCGATCGT
GCGATCACTGCACCCAGGGCCTTTGCAGGAAGACGTGCGTACCAGGGTAAGTTGTCGGCGATCGAAGTTGCGACTGCGCCGGGAGACGCGTGCATGAAGC
TGGCTTGTGGTGCCTTCTCCGAAAAGGCTTGCGCCATGAGGTCCCTACACCAACAACGTAAGAAATCGAGCATGGGGTTGAGCAGAATATCAAACACTTT
TCGTCACGTAC