Description :
From Genome Similarity Track
Location :
contig_134:24284- 27196
Transcript NameFunction/comments
g13667.t1hypothetical protein

Sequence
2912 bases(100 bases per row)
ATGCCGACGTCTACTGGAGCGCACAGTGGTACAAGTGTGGCCCTACCGACACCGCAGCGACAACAATATGGTCAGCACATTGGCCAACATGGCAATGGAA
GGTGCTATGAGCACACAACTAACGATCAAGGGACGGCCAGAGATGATCAAGAAATATGCAGGGGTACTTCGTCATATGGGCGAAGACATGACAGGGTGAA
TGGACAACCGATAAGGTCGCCGGCACGAAGCGGGGAAGCGAAAGCTTGGATCGCACGGAAAACGGCTAGCAATCGACATAAGGGCGGTAGCTAGGACGGG
CATAGGAAGTCATTAGTTTTACTAAGTGACATCAATGTACCTCACTGAAAACAAACAAAACGACAACAACAAACAGGTGCTAGAGGTGTCATTATCTCCA
GCGCATCAAGCAGCAGACCCACAGCCACTCAACTGGAGGTTGCAGCCGCACCCGAACGCGATCCGAAATCAGACCTTGCTGTACGTTTCCGAGGAATTCC
TAAGCCCGGGACACGACTTCATAGTGATCTCACGCGGTTATTACTGCACGACGCCGCACAACTATCAACTGTGGTTATTTGTTCAACTGCTTCCTCATCC
GGACTGTTGGTATCTCTCCGACGAAGAGTTTGACAACGGCCACTTTACGCGTATTGCAAGCGGTGCAACATGACGATTGCTTTCGTGATTCGGAACTATA
AAGTGCCGGACCACATGAATAATTTTCACACTACTTGTGCTCTACTCGTCTTCGGTCATTATTGCCATCAAACCCGCCTTGATAGTAAGTCGTGCCGATG
TCGAGCAATATGATCCGCTTCGAACAATCACTGCGTTCGCATCCATACGCTGCGGTTGTGAGCTCGCCTGTTTCGGTTGCTTTCATCATACATTCCTGTG
CGTTGAGATCATCTGTAGCACCCATAGGCAAGACATGCTTGGGGTTCCTTGATCGATTACGACGGTGTGAGTGTGTTGATTCACGTTAGAAAATGCAGGA
AGACGATACCTTGGCTATGGCGGAGAAATACTTGGTCAATACGTGAAGCAAAAGTGCCGCCCGCAACGAAGTTGAAGGTCGCTTCACTACGCATTTTCAA
ACTCGTCGCTCTCGTCGGTACGATAGTTCTCCTGCACCTTGGAGCAGGGCTGCATGAAGGGGTGCATGTCGTGGAGGAACTTCCTCTAGCAAGTCTGGAG
GTTGTACGGTACGGTAGTTGAGCCGCTGAAGGCCACCGTCTGTACCACCACCTTGTCACTGTACTGCAGCGCCTTCATCACCTAGGGCAGCTCGTTGGTT
TGCTTGACATCGTCCTTGGTCTTGGCCTCCAGCAGCTTGACATCCGCCACTTGTGTGCGTCGATACAATTTTATACTTGGCTTTTGTATGTTAATAATGT
GTGGGCCACAGAGATAGAGGTTAAGCCAGAGGTAGAGGTAGAGGTGAGGTAGAGGTGGGGTGAGGTTAGTTAAGCTTAGTTAGCCAACCACGACAGCTCT
ATCGTTCACGACCCTGTCATCACGCACTGGCGATTGGGTTGACTTTGATATCATTTGCTGGTGGGGGTGCCGCACAAAACTGCCATAAGGGTGTCATAAG
CAAGCTCTAAATGTGTATCTAAACATAACAGCTTCACACGTACTACATGTATAAGTGATAGGTTTCGTGATATACGCCGAAGATTATGGTGGTTGCTTGT
TGAGGGTAGGATCGCGACCTTTGGTATATCTACATACTGAAATGAAGATAAAATGTATGTAGTTGCCAAATAGAACACGCGGTTAGGGTCCATACGTGAT
ACCATTAACAGAGAGTCTCTGTAAGAACTGGGCAAAAATAGCTGATTTGGGGGGGGAACTCGATTTTCATTAATTCCGGGGAAAACAAGACAGACTTGAA
ACCAACACAGTCGGAACGACTGGTATTTACAATGTCATATCGCGCTGGCTGCGTTCGCTCAACGCCAAATGCCCTCCCACAACAGCAGCGTGAAAACATG
CCTCGATAGCATTTTGTATGGCAATTTGTATGGAATTTGTGCAATGGAAGCTGACCTAATTTTAGTACTCAGCAAATTCATGGTGTTCTGGCTGTGGTCG
TATTAGCTACAGACTTACTGAGCTTATCGAGGAGAACGTCGATGAATTGCTCTTCGACGACGGCAAGCCGTGCTCGGTGGCCAAGACCGCTGACCTGGGT
CTCGTCATCGAGACTCTTCGCTACTACGCTGGGTGGCTCGACAAGATCGACGGCTCCGCCATACCCACGTCAAGACCATACCTTTGCTACACCAAGACTA
AGCCTCTCAGTGTTTGCGATCAGATTACCCCGTGGAAGTTTCCGTTGCTGCTTACGGCGTGGAAGTTGGGTCCCGTGCTGTGGGTAACACGATCGTGCTG
AAGCCTGCTGAATAGACACCGCTATCTGCCCTGCGCGTGGGTGAGCTCATCGTAGAGACTGGATTCTCCAAGGGTGTGATCAATATTGTGCCTGGCGTTT
TGCGTCGCGTTGGGATAACTAATTCACGAAGGTCGGGATACTTTCTAAGGAACGATTTAACCATTTGCGGTTTGGAAATGATTTTGGGGTAACCTTAGAA
TGCGTGTGGCTGTCGTGTGAACAAGTACGGCAAGCTCGTCAAAGTTGAAATTTGCGTTCTGTTCAGCGCGCTCGCGAACGAGAATTTGAATGCGTTCTTC
ATCCTGATCGGTCAGGTATTTTCGGAAAGCGGATGGGAGTCGCGAGGCTAATATTTTCGTGTCACTCGTCGCCTCAGTGCCGACCTGTCTGCACCATGCT
GTCGTGCAGACAAGGATGCGTTAAAGCCACCTTCCGTTGTTGCACATGTAGCTGATCGCCATGTAGCTTCATCGTTATCTCCCACGGCAAAATCTTTTCT
GGTGATGCCAAG