Description :
From Genome Similarity Track
Location :
Scaffold_6:24280- 26666
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_6-fgenesh-gene-0.17Conserved gene of unknown function
Pytap_DAOMBR444maker-pag1_scaffold_6-snap-gene-0.34Gene of unknown function

Sequence
2386 bases(100 bases per row)
GCAGGAAGCCACCAGAGCGAGGGCCGTTGGGAGGTGGGAAGTAGTACCGCACGACATCGCGTGGGTCCGTCCGCCACAAGGCAGCGTCGGACCATGGGTC
GACGGGCGGCAACTGCACCGAGATCTCGCGCTGGTGGGTGAAGTCCCATCCGAGCATCGACGAAGTGGACGCATACACGTGCTGTAGTTGCCACTGCAGT
TCGGCATCGTCTTGCTCGCGGCGACGGTACTTCTCACGCGGACGGCGACACCCGAGCTCTCCGCTTGCGTGCAAGTCCTTGATGGCTACGAGCTCAACGT
CTCCGTCTTCATCTTCGTCCAAGAGGTCTTGCCAGGGAATGTGAATGATAAAGTCGTCCAGCTTACGCTTCCCCGAGACTGGACTTTTCAACTCTTCCAC
GACAAACGGAGGAGGCTGGAACTCGCGAGCATGTGGGTTTAACGATTTGCGCGGTCTCGCTGGGCTCGTAGGGCCAGATGCGTCTGCATCCTCTGTACTG
CACTCGCTTCCACAGGCGTACACTTCTTCAGGAGCTTCTTTCTCCGGCTCGCACTCCGAGTCCTGATGCAACTTTATGCCTTCAGCTTGTGGTGGCTCTG
TGGGCGTGTCAGTCTCCTGATCGCATTGGTTATCCGGTTTCGCCTTCTTCTTTTtCTTGCTTTTCTTCTTCTTTTtGGTCGGATTGGCATTTGGTGTTTG
AGCAATGGATGATGTCTTGCTCTCGAGAGATGCCTCTAGAATGAGTGCCTCcATCTGCTGTGTCGCCTCTTtCTCCAAGTGGgCCACGTAACTtCTCAGC
ATGAGTTGCTCTACCAGCATTGCAATGAGGCGCTCGTAATCTTCCCACGTGTTGATCACCTCGCTTTCCGTGATGAAGAGTGCACGAAACTGTGCCTCCG
ACAGGATATGAATCGACACAAGAAAGCCATGGAGTACAGCGGTGACGAGTGCAAACATTCTGTCCACATCTTCCACCAACTCGGTCTTAACAGTCAGAAT
GCCCGTGCCGATGTCCATGAACTCCATCGCTTCCAGTAGATCGTACGTACGTTCACTGTCTGCTTGTGACGCTGTGGACTGCGACTGCGCTGTGTGGGCA
GCATCGGTTGATGACACCGTTGGGTCGACACTGCGCTCTGCCGCCTCCACTGTGGGCGCTTTAGAGTCTGCCAATGCCGTTGTGCTCGGGGTGCTGCCTC
CCGAGGCCGCGACAGTGCGTGCAGTACCAGCTTTCAGGTGGCGTTGCATGAGTCCGACACATAGCAGGCTTAGATTCAGCTTGTAGAGCTGCTTGACCAG
CTCCGCATCATCAACGAATAATATCTGCTGACGCTCTTGCACACCCAGTGCCTCCCAGTAGCGACGCACACTCGTCCGCGTCACTTGTTGCTGCTTTGTA
AGCGCATCGTCTCGGAACGATACTTGAGGCCCTGTCGTCGCTGGCTTGGGTCGTTTCCGTGACCGGTTCACTGAGtGGCGTTCCGAAGTGTGGCCACTGT
CGATGCGAGCGGCCAAGTAGCTCTTCCACACGTGAGCTGTCCATACAAGACGCGTCTGTTAGTCGGTGTGCACTAATTTCCTATTGCTCATGTGCTCGCA
CCGTCGACATTCGCGGTCGCGCGTCGTGCCGGCGCCATGCTGTGCACCAGTGAAATCGGGTGATGGACTGGAGATCCGAAGCTCCGAGTTGCGCGATACG
ACGTGGATGCGCGTTGTCACTTCAGTCGAGTGGCTGCGCAGTCGATAGAAGTCGCCTGAAGGCAGTCTGTGTCGGAGCGGGAGGCGGTAGTGACGATGAG
GATGCCGATGCGTCTGGTCTCCAGCCATGGAGTGTCGCGTCAGTCGTGAACAGGTACAGAATGAGCAGCAATATGACTACTTGGTAGTCACAACACTTAG
AACACATCGAAAGTTCGATTGTCAAACGAAGGTGCATGGATATTATCATTTCAAGGTACATAGTTTTTtAGAAAAAaTAGGAACCTCAAGGAGATAATTT
ACCCACTAATGATACACACAGTTATAAGCTTGACCTCTTCTGGGATTTGACGGTACTGGAAGAGAGTGCATGTCGGCGTGACGACAGCATCGAACGGGAC
GACGGAACATGGCGGACATGCAGCACAAGCGCGTGGCGCAGCGCCTGAAGGAGGCGTGTGAGGAGACGGCGCGCCAGGCCATCGCAGCGACCACGGCCAC
GGGGCAGGCGTCGCGTGTGCACCACAAGAACGCCAAGTTCGGCAGTCGGAAGGAGGCGACGGCGGCCAAGGTACGGACGGGGATGGAAGAGCATGGCAGG
TCGGGTGGCGATTCtGACGCCGTAGCGATGGGAACCaGATCGCAGCCGCCAAGGCGAAGCGAGAGGCCAAGGGGGAGAGTGCCAAG