Description :
From Genome Similarity Track
Location :
Scaffold_34:24279- 26078
Transcript NameFunction/comments
Phyra_78703Hypothetical protein

Sequence
1799 bases(100 bases per row)
ACAATGGGGAAGAGTAACGCACCGCAGTCTCCGGTGCTCACACCGCAGACGCTGACGCCCCAAGTCGATGCAGTCTACAGCACCAAGTTATGGGATGCGA
GAGCCCCCAAGTACGCGACGAACGTCATGCGGAAGGTCTGCATCTACCTCTTCATCGTGACCTTCTGTGAAGAGCTCGCCGGCTACGGCGTCAACCAGTC
CCTCAAGAATTTTTTCCAGAAGCTCGGGTGGTCCAACAAGGGTTCCAACTCCATGAAGCTAACCTACGATTCACTGAGTCAGTTCGCTTGCATCGTCGCC
GCGTTCATCGCAGACGAGTACCTGGGCAAGTACAAGACGTTACTCGGAGCTGCGTCGTTCAGCTCGGTGGGCTTCGTCCTGATCGTGATTGCGGCTTTGC
CTAGTGTCCTGGAGAACCAACTTCTGAGCAAGGTGCTCTTCTGCATTGGTGTTTTCTTGGGTATCGCTCTCAATCAAGTCGGCATTCGCGCCCTGCTGAT
ACCCTTCGGTGGTGACCAGTTCTCCCCCACATCACCACCAGAGCAACGTGATTCGTATTTCAGCATCAACTTCTGGGCTTCAAACTTGGGTGTCGCCTTG
AACTACGCTGTGTTTCCATCGCTGTCTCTCTACGGCATTGGCGCTATTCCTGCCGATTACGGATATGTCGCCGTTTTCGCTATTGGTCTGGCCCTTATGC
TGAGTATAATCGTCAACCTACTCTCAACTCGCTCTCGCTACGTGAACGTGCCGCCCACGAAGAGCGCGCTTGGCAGCGTAATCCATGTGGTTATTCGCAG
CGCCAAGCACAACTTCAGTGCGAAAATGATTGTATTCGGCGGGCTCTTATACTTGACCGCTTTTTCCCTGAATATTGTGGCGGCGTTCATGTCTGACGAT
GGCGAGGTTGGTCACCGCATCTCGTACGTCTGCGGTGTATTAATTGTGGTGGCTACTATCTTGTGGATTTACTTTGCACAAGACCCGAACATTGTTGAGG
GGGCTACGGACACCGACGGTACCGAGTTTAACCGGGAGATGATTCGTGGAGTGAAGCAAGTAATCTACATCCTGCCATTCAACGCCTTCAACATGTTTTG
GTGGGTCTGTCAGAACCAGCGTGGCAACAACCAGACCATTATCCAGCAGACCGACGTACGCTTAGGCAGCGAGCCCGACTCGACCCAAATTCCAGCACCG
ACAGTTCAATTTTTCAACCCTGGGCCTGGATTGTTGCTCGTCCCCTTCTTCCACAAACTGGTCTACCCACTCTACGAGAGATTCACTGGAAAGCCACCGA
GCCGCTATGGAATGGTTGGGGCAGGTTACATGGTGGCGATTGTAGCAATGGTATGGACGGGAGTGTTTGAGATCATTCGCCGTAACTCACCGCTGCTAAC
ATACGTGGACGCCGATGGAGAAACGCAATACATCTACAACAATAACGGTGGGAACCCAATGAGTGATATTCGGTGGTACACAGCCATTCCTCAGTATGTG
TTGGTCGCTGCGGCAACGGTACTCATTCAGATCCCAACGTACAACATTGGATACACCGAGGTTCCGATGGCTCTTCGTGGTGTGTCGATTGCTCTTGGCC
TCTTCATGAACTCGATGGGAAGCACGCTGCTTTCGGTCATCGTGCTGCTGTTCGGCAAGGACATTCCTGCAAACCTGAACGACGGGCATATGGAGTACAT
GTACTTCACCATTGCCGGTGTGATGGCTGTGAACGCCATTTTTTACGTCCTGGTCATGAACAAAATGCAGTTTGCCATGATCCCGAGGTTGGGTGAGGA