Description :
From Genome Similarity Track
Location :
Scaffold_204:24279- 25852
Transcript NameFunction/comments
Pytap_DAOMBR444snap_masked-pag1_scaffold_204-abinit-gene-0.40TBC1 domain family member 22A

Sequence
1573 bases(100 bases per row)
GTGGCTGGGGgAGTCGGCGAAGTATGTCTGCAGGATGAACGCACGCGAGAGCAGTGGGTCGATCTCGTCCTCGaGCCAGTCCTTCGTCGGGAGATGCTGC
AGGAAGAGCACGAGGTCCTGGAACTCGAGCGTCTTGAGCGTCTCGCCGAACGTCATGAGGATGCCCGCACACACGTACACGTGGAAGCTCTCAAAGCCAT
TGTCTTCGCATAGATACGTGTCCCAaAGTCGGATGATCGCGAGTAGCGGCAGCTCGCGCATGAGCAGGCAGTTCATCCAGCgAAaGGCGAACTGCACGAA
CTGCACGTTCTCCCGCTCGACAATGTGCTTGAAGAGGTCTGCGTCACAGCGGTGGACGAGCTCCTGCATGTGATGCACCATGCGTTGCAGGCCAGGCTGG
GCGAAGGTGTAATGGTCCTGGATGCCGTCCAGGAGCTTGGTCAGACACCAGTACGAGTCGGCCTCGACAGTCTCGAGCTGCTCGTCCGATACGACGCTAA
GTTCGCCGTTTTGAGGATCATCTAAGCCCGAGCAAACACAATCAGTCCGAGTAGAGAGTAGAGTGGAGAGAACGAGCACGGACCCATGAACGGGGACAGG
AAGACAACTAGGAACGGCGTcAAAaGgTcGTTGATGCCTTGAACGTACCcACTGGCTGGGTGTCTGATAGCCCATGTGTACAGAACACGTTCCATGCACT
GCAACGTCATGATCAGGATGGATCAGTCGGAGTACAGAGATTACCATGGCAaaCCTAACCAACCTGGTGGATCCGCTCCTCCTGGAACAGCTTGACCTCT
GCATTGGTGCGAGGAATGTCGACAAGAATCTGCCGAAGCGTTGTTTGCTCTTTCACCCCGCGGTCTGTGTCTGGAATGTAGTAGTATTGCTGAAGTAGCT
CCTTGTACTCCTGACGTTTTCGCTGCAGCATCGGCTCTCTTCGCTCCTGCTTGGCTGGCATGTATCCCTATATCGTGAGATTCGCATCAAGTCAGGTACA
TATACTGCCAAAACAAACCACGAGACAACTCACCAACAGTAATCGCCACACGTTCGGTCGCAGCTCGTAAGGGATGCCACCCCAGCTGAGCTGCCGCAGC
TTGTCGAGGTCGACTGTATCGCTACGCAGTAATGAGTGAAACTGTTCGCAGCGGTGATTACCAGTCGCATTCCGCGACGAAGaGCGGGGCGCCGGTGGTG
TTGGTGTAGTCGTagTAGCTGAGCTTGGTGCCTCCAGCGTCTTCGACCCGATAGACAGTTGCTCCAAtACAGCCGTGGCTtCCTCGTCATGCTCACTGCC
CAGCGATGCCGTCTCTGCCTTTGTGATACCGACCTTTGGTGAAGACATCTTTCGAGgCGgTGCAGGCGGTGGTGTCGCCCACACAGGCGGTAGCTGGCCG
GCGCAAACCTGCTTGACCGATCCGGgCAGCGCCTGCTGCTGCTTGTTAATGCCCTTTGCTGCTCGAGAAAAGAACCCAGTGGACCCGGATGAGCCAGACG
CCGCGGCTGCTGCGGCTGCCTTCTCTTTCTTCTTGGCTGCGAACTTATGCAGGGCATTGCGGAACGGATTCGA