Description :
From Genome Similarity Track
Location :
Scaffold_178:242782- 244526
Transcript NameFunction/comments
Aphin_H310_06599PREDICTED: RING finger protein 215-like
Aphin_H310_06600AlNc14C375G11155

Sequence
1744 bases(100 bases per row)
CCACGCAAACACGCGCGCGACGGCTGGACCGTCAGGGTCACATGCTTGAGGGAGTCGTCCAGGGCCTCCTTCAGGCGAACGAACCATGCATGTCGAGGAT
CCATTGCCGTCACTGGAGCCGTGCAGCCGAAAATTGGCCGAATGGGTTTCTGATCAAGACCACAGAAACCGATAAAGTAACGACCACGATATGCGTTTTG
AGTTTAAACATGTTTCAAGAACGTCCAAGTTTCTTTCACTGCCTCAGGGATATCCAATGGACACCCTTGACCCGAGGCTGGGATGTCCATCGGGTGCCAC
CACTTCTATCGTTGAAGTTACTTCGTCAAACGCCTTTCTCTTGTCGAATTGCCTGCAGCGAGCCCTGGCGTCTATGGGATGCTTGGGTTTCTCGCGCTCG
TGTGAATGTTCTGTGGATGTCCAAACGGCACAACTACAAGAATCGTACAGTCAAGGGACGCTCGATATTGGCGTGTCCAACCGAAGAGGTTGCGAAATAA
CGCGACAGAGTAAAACCTAAAACCTACGTTTAACGCTTTTAACTTTTAAGAATATCGCCAGAATGTTACGCAAATCCGTTTCCTGTGGCACGGATATGCG
CGATGGCGGTGTGGAGGATTGTGACCGCGTACGCTTCTTCGCCGATGCTGATGCGATCGGGAAGGAATGCGTCCATGAGAGCGAGGTGCGACGCCAAATG
TGGGCAATTGGCCATGACCACAACGTAAGCAAGCACGGAGACCAAAGCATCTGCAGCGCTACAACATGACCATAAGAAGTGGGGACCATTGAAGACGTCG
ACTTACATGTGGAGTTGCTCGACGGGCGGAGGATTTGGATGACCAGCGTAATACGTATGGATGGTAACGTCGATGAGACGGCAGACTTGGGACACAACTG
CGACCTTTGCTGACGGTGATCGTTGATGAGGCAGCTCCGACATCTTAGTAATACAGTTTGTGTATGGCGTCGCATGTCGCAACGAAGATGCGTCAAGACG
ATACAGCGGCGGCACACCGATAGACTCGGCAACGCAAGGTGAGTGCCGTAGGGCCGCCATGATAGTCGCGAGTGAAATATCGGCGGAACTGCATTGCGCG
GTGAATAGACCATGCAACGTTGGCTGCAGATGCACGAACATGGCATCTTCGACCGCTTGTTGGACATATACAAGCAGAGACGCAGATGCGAGGGACGGGT
ACTTGAATCGAAGCACTTGTACGAGCAAGGCGCTGAACTCGATGACGTCGTCTGCGGCGCATGAAGCAATGGCTTCCTGCATCGGACAGTGCACATGCTG
TTCGTAGAGCGAGTGGAACACAGTCGCAAAATCGAGCACGACATTTCCAAGAGAGTGCTTGATCGGCCGCGTGAGGGAACTGGTCGTTGCAGCTGTACGG
AAAATGGCACGAAAGTGGTCTGCGATGACGGAGGCAGGACATCCCATGGGCTGTGTGATAACGCGAGTGAACTCGTCGTCTACAAACTGTGCCAACGCTT
GCTTCTCAACGGGCGGTAGGTCGATAAACAGGTCGGCAAACACACTGCGGGATCGAATCGTTGCCTCAGTCGATGACAATCCTCGCGGACGGCGATGCGA
CTGTCGACTTGACGCTGCCTCCACGATACGAGCGACTCGCGTCGAGCGAGTCACAGTGGCTTCTCTGTGCAATGTAGCGTGATCGTCTTCGTCGCGCAAA
GCTTGGAATGCTCGAAGGCTTTCCTTCGGTTTGAACTTGTTGGA