Description :
From Genome Similarity Track
Location :
Scaffold_135:24278- 25933
Transcript NameFunction/comments
Albla_Nc14079600conserved hypothetical protein

Sequence
1655 bases(100 bases per row)
CTCTGTGAGATTCAGGACTGCACTCTTGTCGTCGATTCCATTACGCTTATCGTTTAGCGTTGACATATTTGCCGACAAATTGGATACTGGTTTCTTGTCG
AGCGAATCCAAACAACCCATTTTGAATATCGACATTACAGTTCACAATCTGAAGCGCGAAGACGATGACAACGTCATCGGTGCGTTTCTTCTGTAGCTCT
TCTTTCAATCAGTTTTGACTCACCAGCTTGTCCAGCATGCGGTCCAATATATACGACATTGCGTTGCTACCAAGAGAGTCAGACACTATGGATGGATCGC
CTGCCGGGTCGGGGGATATGTGGTACCGGAAATGCTTTCTTTTGTGCGTTTGGGCTGGATGGTGGTCAAGTATTTATTCTCAGTATTCGAGGGCAGCGTC
TCTTCCCCTGCATCAGTAACGAATACGAACCATTTGTTATCACTCTGCTGAAACTTCTTTAGCGATTGGTAGTGCAATTTCTGTCATGGAGTGCTCTCGC
GGCAACTCGAATCATCTCCTGGTGATATCAACGAGTGGAATAGTTCATATCTGGAATATTCGAGCACGGAAGAAGCTCTTGACCGAATCGATTAACGCAA
TCATCGGAGTAAGCGATCCATCGATTTCTACGACCAGAGACTTTACTCAAAATATAGGGAGAGACCGGCTTCAAAGTGACACTATTGCGCTGTCAGGTAA
CAACACGAGGCATGCCGATCCTGGCAGTCACCAAGAGTACACGGGACGGGAACGGACCCTCAAGCTTGGAGAATTACATCTTCGACAAAGATATGGCGAG
CTGGTTCGACTTTCTATGTGCATTGTGTTGAGGCTGACGTTTTTACTGATAGGATGCGGGTTACGGATACAAGCTTTATGTATTCTGATTTTAGCACATC
GCTGCCCACCAATGTCGTATCAGGCAATAGTGTGCCGGTATCAGCATCCCACTTAGCGAAAAGCATCGTATTTATTTCGGTGCTGTTAGATGCAAATACT
TCGACAGCTACAGACAGCTTCAGGCTCTGCACGATCTCAACGGGGCATCCCATCAGCCATGCTAAGCGAGATGACTGATCCGTATTTACAGCGGAACCTT
ACGCGCTCACATTTGGAGCATCAAATCGCAGCCTCTCGCGTGCTGGAAAGTCCGCAAGAGTACCAGTACTGGTATGGAACTTTTATGTTTCCCTGCAACT
TAATGATTTTTTGTGGTCAGGCTGACAGCATATGCGAAATTCCTGGCGCAAGACGAAGATTTGAGTCGTTTGGATGAGCTTTGCACTGAACTACTGGGTC
CAATTCATGAGTAAGTTCCATTTCGCATGCTACGCTCCGAGGGACTGACTTCTGGTAATTCTCAGACAAGTAAAAGGATATGAAGGGAGCTGGAATCCGT
GTATACTCGTGAGATTCTATTTCATTTAGAAGACTAGATTTACAAGTGTTTGTGCAGGGAATTCCTCGAAGAGAATTGGTCCGGAGTGCTGTACTGCGTT
CAATTGCGTCCAATCGTTCAATGCAGCGCTTAGTGGCCAAATTCCAGCTATTATTGAGAGAAGCTGACGGCATCGTGGAGCAAGAGCGTGAGAAGAAAAC
CTGAGTGCACCTTTGTAGAAGTATCATTTTTTCGCTTTTGCCGGTGAACAACTAT