Description :
From Genome Similarity Track
Location :
Scaffold_25:242693- 247541
Transcript NameFunction/comments
Hyaar_Emoy2804047hypothetical protein
Hyaar_Emoy2804046Metal Ion (Mn2 iron) Transporter (Nramp) Family put
Hyaar_Emoy2804048hypothetical protein

Sequence
4848 bases(100 bases per row)
TAATATACTTGTGATGTATCTTTTCTTTCCGAGCTGGGAGCATGCAGCTCTAGTCTTGATATACGCGAGGGGCTGTGCGTGTGCGATCGGCGACCAAAAC
CGTTCCAGTACGAATCAAGTACCACAGGAAGCCAAAGTACAAACAACAAGCGCCTCCCAAAACAACGAGCCCCGTAACACCCAAAGCGATATTTTCCAGG
TTTGTGAAGATCAAGTACAGATTGACGACACACACGAGGCCGCCCAAGAGCCAGCCAAATACCACTGTTGCTTTGTTATTCGCAAAGTCTCCCATGATGG
TACGTGAGCTCGTGAAGATCAGTACGGGAAGTAAAGCAAACGGCAGCTGGATCGACTGCAGTACGTTGAGTAACTCGTCCATGTGATCACTTTCCGCTGG
GTTTTGCTGGCTTAAGATTGCGACAGTCAGTGCAGGAACAAGCGACACACATCGAGTGAGCGCCACACGCTTCCATGGCGACAGTTGAAGCTGCAGAAAC
CCTTCCATGACGAATTGGCCCGCGTAAGTTCCTGTCATGGTGGAGCTCTGTCCTGCAGCCAGCAGACCGATTGCCCAAACGACGTCAGCGTACTTTCCCA
ACATGCCGCTGAGCGCCATACCAGCCTGGGATAACCCGATCTCTTGACACATACCTTCGTCACCATTAGCAAGTTGGCAGTGTCCATGCGTGTTGTCATT
AGCAATAGCTACAGAGACGCAGGCTGTGTTGACCCCGCTTGTGTCAAAAGATGCTGCGCAATCTGGCGAGAAGAAGCCCTTTGCAAAAACGGCCAGTACG
GCCAAATTGATCAAGAAGGACACCATTAGCGCCAGACAGGCCTCTATTGCAAAGTATTTGTTCGCCTCGCGGACGTTGCCTCCACTGTGTCGATTTACTT
GTCTAGACTGCACAAGTGCTGAGTGCAAAAAGATGTTGTGCGGCATGATGACGGCCCCAATAATGCCCACAGCCTGCGTCACGGCATAGTGATCAACACG
CGGCACAAAGCCACGCACAACGTCTGCTGATGCAACGTCTCCGCGGACCAAGTTGGCGCAAAAGCAGACCAGCATCACCAGTATCAACGTGACAAAAAGC
GCTTCAAGCTTGCGAACCCCATAACGGTGAAGCAGTAAGAACGTAAACGTATCGAAGCCTGTGATCAGACATCCAAGCCACAGCGGGAATCGAAACAGCA
CTTGAAATGCAATGGACGAGCCCAAAACTTCTTGCACGTCACTACCAACAATTGCAATTTCCGTCATGACCCACAGCGTCAGTGAAGCCCACCGGGGGAA
GACGGCCGTACACATTTCCGCCAAGTTTTTGCCAGTGACTACACCCAGTCGAGCTGCCAGTACTTGGAGAAAAAAGCCCATTGCGGTCGCACCAAACAGG
ATCCACGTCAGCTGATAGCCTGCATAGGCTCCTGCTTGCAGGTCGCTCTCGAGGTTCCCAGGGTCCACATAAGCAATGCTCATGAGCCACCCTGGTCCAG
CATAAGCCCATAATGTCTGCCAGCTGCAGATATCAGTACTAGTAAGTCGCCTCGCAAGCGTTACACGCATTTAAAGCAGATGGAGGTCACCTAAACTTGC
GCGAACTCGGTTCTTCATCAGAAGTTGTAGGAGCAGTGGATGATAGCGTCAGGGTCTTGTTTACGGCGTCGTAGTCAGCTACATTCTTGGCTTCGTCCGC
TAGCAACCGGCGCAGCTCCGGTGTTCGAGTCTTGATCATCGTTTACCAATTGGAGCCTACTGATTGGCTCTTTTAAGTGATGAGGATGACACGCAGCGGA
GTCTGTAATGCGCTATAAAGTCGGAGATAGAATTCATGTACGGAATTTTTAGCTGAAGTAAGAGTGCAGTAAACGAATAGAAAGGTACAGTCATAAATTA
GAGCGCTATATATAAAAATAGAATAGCTTCCTTATAATCGCTCGCATGCTTTATTCGTTACAGCTGATTAGCAACGCTATTATCTCTTGGCACTTTTCAT
CGGATAAATGAATGCTGCCAAAAGTATATCATGATCAATAGTGCGATCAACGTAGTATTGCATGTACTACAAGCCTTAAGTTCCCTCATGAATTCCTAAT
GCTAGAAGCCAGATAGATAGAGGGCAGACTCGTCGACAACAGCACAAGACCTACAGCAAGAAATGTTGTAGGAATCATCATGCTGTATCCTCAAATGCAT
GCAGTCCAACGCTATACTGTAAGCAAACAGCTAAAGACACCTCTCCTACTCCCCACGGAGTTTGCGCGTCTGTGGGGCAGGGGCCGGTGGGCAATCTTTG
TCCGTCGTCACCTTTACAAAACTGCCAAACCACGCCTTGGTCTTGCTCCACCAACCTTCCTTACACTCAGGGGTAACTTTACCGCTGCCCGAAGCGCTTG
GGCTGCCAGAAGCGGCCGGTGCATCTGTAGCAGGAGGCATCTTCAGGCCACCCAAGCCGCCACCGAGGCCTGAGCCTTTCATGTCCGCAAAGAAGTCGTC
AAAGTCCATCATTTCACTGCTGGCCGAAGCGGACGAACTGGTATGCTTCGTCTTTTTCGAAGCCTTCTTTGAGTCTAGCGAGCCGCTGTTCATGTAGAAG
TCCAGGCTACCCGAAGACAGTCCGAGGGCCTTCAGGAAGTCATCGAATCCACTGCCATCCACTGAAAACAGATCATCCTGCTCACTGCTGCTGCCGCTTA
TATCGAACGAACCGCTGTCTTCCTCGCTTGAGCCGGTCGAGTCACTTGACCCACTGTCTTCGTCACTTGAGCCAGTCGAGTCACTTGACCCGCTGTCTTC
GTCACTTGAGCCTGACCAGCTCTCTATGTCGTCATCGTCATCGCCGCTGGCAGAGTCAGAAGCAGCCATCACACCTTTCTTCGTCGTTGGGGTCATCCCG
GCGATCAAAAAGGTCGGATCAAAATCGAGATCGAGGCTGTTGCTGTTGCTGTCTTGTCCGACTTGATCAACGAGACCGCCCAGACCATCACCAGAGCCGC
TTGCACCAGTCGACTCACTCGAGTCACTGTCGGCATCGCTCGAGCCCCAGCTCTCCATGTTGTCATCGTTATCGCTGCTGGCAGAGTCAGAAGCAGCCAT
CAGACCTTTCTTCGTTGTGGGGGTCTTCCCCGCAATCAAAAAGGTTGGATCAAAATCGAGATCAAAGCTGTTGATACCTTGACCAACGAGACCACCCAAA
CTATTACCAGAGCCGCTTGCACCAGTCGAGTCACTTGACCCGCTGTCTTCGTCACTTGAGCCTGACCAGCTCTCCATGTCGTCATCGTCATCGCCGCTGG
CAGAGTCAGAAGCAGCCATCACACCTTTCTTCGTCGTTGGGGTCATCCCGGCGATCAAAAAGGTCGGATCAAAATCGAGATAAAAGCTGTTGCTGCCTTG
ACCAACGAGACTGCCCAGACCATCATTAGAGCCGCTGGAGCTGGTCCACTCACTCGACTCACTCTCATCATCGAGGCTCGAGTCAGGAGCGAGCATTATG
CCACTCTTGGTACTTGGGGTCTTGGCTGCGATCACAGCTGCTCGGTCAGGATCGAGGGCGGAGCTGCCGTCGTCTAGTCCATTGTGGTTGTGGAGACTCT
CCGGGTTACCAGCCGTGACGACACCTTCAATATTTACGAACAAAGCAATGGCTGTCGCGAGCAGGACGTGATTCAGATGCATCTTGTCAAGTTGGTAGAA
GCGCGAGGTACAGGGTCTTGTTGGGCTCGAGGCAAAATGAAAAGTGTTGGCCACAAATGAATGCAAAGGACTATCTCAACGGAGTTCTTCTCTATACTTG
ACCGACCAGATCCCGAGACTGGTAGAATTTTACCCAGCTCCGGTCAGGCTTGGCGCAACGTGGACCTCTAACTTCGTTTCGAGCAAGTGGCCTATAGTGT
AGTAAAGTCTAAAACGACTGGAGACAAGCGAGCTCTTTTTTGAGACCTTGAAGAATTGAGGATAGGAAAGGGGCCCACTATCCAATGCATAAAACAGTCG
AAGACCAGAAGCTCGCGAGCATCTCGTTGGAATGGATCTGGTCGTGAAACATGCAGCGTCCGAGGGCTCAAAAACTGATCTTTCTCGATGACCCGCGATC
TGGCTTCAGACTTGCGTACTCATCTGACACGCAGACATAGTGGAGCCATCACCGGAGACATCTTTTCCCGCACAGACGAGAAGGATTGACTTCCAGCACC
TCTGGCTCGCAGAAACAGCTGAGAAAATGTCCATGCGCGTGAACATACTGCAAGCGTAGGGAGGTTGGCATCACGACGTTGGATGTCGTGTTGTTTATCG
GGCGATAATGCTGCCAAGCTCATGCGTTGAGATAACAACGATCTGGACTTACGACACCTTTGTGCGCACGGGTATTGTTTGCTCTCAGATCAAGGATACA
GTCCTAGCTGCAGACATCGTTGTATCTAAACTGTCAACAGCGCTCAAATGCATGTAGGAAGCCAGCACATGGTAGATGTATCAATACGTAAGTGATTGCA
CTGCTAGCAAAGGTCGACCTCAGATTGGCCTACTTCACCATAGAATACCAAGAGAGACTTATGGAACGAAACTTGCGAGTGCCCAAGGGATACGTGCTCA
AGGAGAAGAGTACTACGTGGGGTGAGGTGTAGGAGGATCGCTATAAAAACGTACTTAGTTCCTTTCTACGTAATAAAAAAGAATCAAACGCTGCAAACCC
ATCTCCTTCGTAAGTTCGAACACACAATCAACAAGGCAAAAGTGTATCGATGTATTTTTATCCTCTGCGCCTGTGGCTGTGTTGCACTTTGTAAGCATAT
AGCGGCGTTGATATGCGTACCTCATCTTCGTAGGCAAGTCACGAGTGA