Description :
From Genome Similarity Track
Location :
Scaffold_436:2426- 3871
Transcript NameFunction/comments
Phymu_g9890hypothetical protein

Sequence
1445 bases(100 bases per row)
GCTTTGCTATGAAGCTACACAGGAATCACATGAATCAGAACGCGACGAAGATTGAGATCCGCTGGTTGGCGGCATGGTTCAAGTCATTGGCGGCTACGGT
GGGCGATGTGGTTCCTGTGCGTGTTCGGACGCAAAAGACGGTAGATGGCGTCGTCAGAAAGCAGTACTCGGCGGAGGACTACACGCTGCTATCTGCAAGC
TTCACCTGGGACTATCTTTACAGCGAAATGCACAACTACGTGGTGGAAAACGAGCTAGATGTCCGTGAGCCTCAACCGTCCACATTTCGGAAATTACTAC
AGAGCTGCTGTCCTATGATCCGGATCCGTTCGCCGCGCAGCAATGTATGCGATCTCTGTGCAATTCTATACACGAGAATGAAGACTGGGATAACCACAGA
GCTGACTGAGGCGTTTGGAGGGCACACGACCGCTGCCAGAGCCATGAGATATGGAAAAGGATGCAAGGATCATTACATTTTACCATGGACACTAAGATCA
TTTTAATTTGCTGTGAACATTTGTTTTTTAGAAAGGAGTACAAGCAAGACTTGGCAACGGCTTCCGATGGCCATGCCGTCATCATAATGGACTACAGCCA
GAATTCGACTCTCCCCAGCGTCACCTCAACGCCATCCCAGTTGTATGTCCTGTCACTAGTAAACGTATACACCTTCGGGATCTACTACGCGAGCAAAGGC
ATGCCGTACAACTACGTGTATGAAGAGTCTGTTGCTGCCAAAGGTACCGATGAAGTGAGCTCCATGCTGTATCACTTTGTGCACCAGATAGTCATCCTTG
CCGGCTAGAAGAAGCTGACAATTTATGCTGACAATTGCGGCGGACAGAACAAGAACAACTTCGTGCTGAAGAACTCAGATGGGGGTGTTAGAGTCTatcg
agttgaagtttttCGTAAAAGGACACACCAAGAATGCCGTCGACCGTGGCTTTGGCCACATCCGCAAGAAATTTGCCCGGGAGGACGTATGGACCATGCC
CCAAATGCTGGCTTTGATCAACGACTCATCGACAAGCTCTGCCCTCGTCCACATTGACATGCAAAACTCTTTGATGAAACGGTTTCGCGATATTGTTCAG
GAAGCCTACAAGGACTTAAAAAGCATCCAGTCATTCCATATTTTTTCGATGGAGCTCTCAAAGCCCGGGGCCGTGGCGTGTAAGGCTGGTCCTCCTAagg
aagctcaagttcaagaTCTGCGTAGATCCTTTGACAATGTTTAGACCGACGAAACAAAGCTGCGTGGTCTATACGACGCTCACCTCGAGCCTCTGGAGCC
TCCTCTGCCTAACTTCAAGAAAAAACAGCAAATGAACAACAAAGTGAGGCCGTACGTTCCAGCTGATTTTGTATCGGACCCGATCTACGCTGCCCCcacc
gacgaagaagagagaCAGGCAAACGAAACGAAGCGAGCCCGTCAA