Description :
From Genome Similarity Track
Location :
Scaffold_41:242595- 249195
Transcript NameFunction/comments
Sapdi_VS20SDRG_11390hypothetical protein
Sapdi_VS20SDRG_11391hypothetical protein

Sequence
6600 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAGCGCGAGTGTACGTCGGACGGCCCATGGCTTCTACAGTCGACTCCCTCTAAGTGCATACCGTGGTACTTATG
AATCGGAGAGGTTTATCAATTATGCAGAGGTCGTATTTTTTTAAATGCAATCTCCATACGTTGGATCGATCACACAGTGGGTCCTACTCTTCGTCATCTT
CGTCATCTTCCTCGTCGTCGTACTCGACATAGTAGCAGATCTCGTGAGCCGTCATGCTTCGCCAATGCAAGCTCATCCGTCTCGCCAGCAAAGAGGTATG
CACTTACGTCGCAGAGAGGTATGCACTTACGTCGGCTGCCAATCAATGGGCGACACGTCCCCAGCCTCAAGGACTCGAGACCCATACCATTTTTATAAAA
ATATTTGGGTGATATATAACGGGAAGAGTTTTATCGAGTTTCAGTGGTATGCACTTAGAGGGAGTCGACTGTATTTCAGAATCTGGTGGCGTTCAAAATC
TGGTCATGTCCACGTCCCGTCCCCGTGCGTTGCCGCCAGACCGCTGGTCTCTCGCACATTTCGAAAAACACGCGCTGCCGTCAACACAAACAGACAGTCG
TACTACAATTAGGACCACAATTAGCACTTGTCGTGGACAAAGCTCGAGCTCGTAATGTGCGTCAGCAACGGAAACTCGCGCTTGAGGTACGCCTCGCCCT
CGGCATAGATCTTATCCTGGTCGGGCTCCTCGCCGTAGCCGGCGTAGATCTTGTTTTGGAGCACGTCGAGGCCGCTCGTGACGATCGCGAACGGCGTAAA
GCCCTTTGCGTCGAGGCGCGAGTTGTTGGCAAAGTTGACGTACACCTGCGTCGTGCGCGTGTTGGGCGCTTCGTCCATCGCATACGCGATCGTGCCCGCG
AGGTTCGAGACAGCAAAGTTGCGCGGGTCGTCCGTGATGTTGCCGTACTTGTCGTTGATCTTTGGGTCGGCCGCGATGCCCCACTGCGCGACAAAGTTGG
GCACATACCGAAAGAACGCCGAGTTGTCGAAAAACTTGTCGGCGATGAGCTCCTTGAAGCGGGCGGCGCCGAGCGGCGCCCAGTCCTCGTGGACGTCAAT
GGTCACGTTGCCGGCTTGGGTCGTGAAGAGCACCGAGTAGACCTCGGCGTTGGCGGCGAGGAAGAGCGACGAAAGTACGACTGTCTTCATCGTGGCGAAA
GGGCAAATGCAAAGTGAAACGTCCGAGATACGCCTGGAATATACTGTACGCTCTACGATCTGAGTTGCCTCTCCTACATGTCTGTGTGCAATGGTCCACC
CAAGCCTCAAGACGACGACGGATGCATGGGTACGATCGCTGTTGATGGTGGTGCGTCGGCTGGAAGAGTTCAAAGCTAAAGGACGATAGTGAAGAGCAGG
AAATCATCGAGGGGCTTGGACCTGGACGCGCCGTGTAGCAAGAGAGGACGGTGGGCGTTGAAAACGAAGTCACCGATCCACTTCCGGATTACGTTCGTCG
AGAGCTTCGTCATGGGAGAAACACCCAATCAGATCGAATGCAGCGGTCTGGGATCATCGCCGACGACGCACGATCGCTGTGTTTTGTGCCCCACCTCTGG
TATTTACCCCTCGGTTCGTACCACCGTACTACGTGAGGCTCATTGCAAACGACATGTCCACTTGAGCCGGGTTAGTATGCATGCACTCGAACTAGCTATC
GACTGCGCCCACCGATCTTGCTGGATGCCCCGGGTTATGCGGGTTATGCGGACGGGCCCCATCGGAACGACGCAGACAGGCGGTTTTGATAAATTGATAG
AATGTTTTGTCGCCGACACAGTCTTGGGATGTCCTGAAAATTCAGAATAAATATATTTCTGTCATACCGCGTAGGAACAAGAGCCTCATGAACTCAAGAC
GTCTCGACGTGCGCACCAATGCACCATCGTACGCACGAGATACCACCGAGGTTCGAAGGCTACAGACCCCTTCCGCTGACCTCCTGCATACGTGGCAGAA
CCCAAACTCTTGCAGTGCGAATGTTGCTGTAGACTGCGGGCTTCAGAAGCGAGTTCTCGGTTGTACGCGCGCTATGGACGACCACGTTACAGATATAGAC
TCACCAGAATGTACACTATCCAACGAGACTGAATCCAGACGTAGGAATTTTTATGACGAGGTGGCCGCCGACGTCGCGGCCGACGCCAGCGCCAGCCTCA
TGTCCGGATAATGTCCGGATAATCAGTGTCGGGTTGCGATGACATCACGCGTGCTGCCCGATCGATGCTTTATCGCGGTGTGCGATCGTTGATGTTATCC
AAATGCATAAATCCGATCTGAAATAGCTATCTGGTCGATAGCATAACTTGCTAACATCAACTATAAAAGTTAGCAAGCCATCGTCGACACCTAAGCAAGA
GCTCGCTGGACGCACAGTGGTGCCTAGCTGACGGAATCGCGCCGGAACCTCTTCCTTCTACTATCACCAGGGAAGAGCTTGGGACACGGCTTCGAACCAG
CGGCCGCACCTCACACCTCTGGCCAGTCACCCACTTGGCGGCGCGGTCTATAGTTCTATGGACGCACCCGTCGCTGCGCTTGCCCATCGCGGCGCCTTCA
AGGTGGACCCGCTGGCTCCTCGGATGCCATTGGCTGTCCGCATTTTCCGGCGATACGACTTGTTTACGGGAATTCAAGCGCCAACCCTCGTCGTTTGGGT
TGCGCTTCTACCCTTTTACCTGACGTTTTTATGCAAAGCACGGCCCGTCGCTTGGTAATTCGCGTATGTAGTATCTTGGCCCACCACAGTCCACCGGCTG
AGCAACTTATTTGGTCATCCGATGACGCCGCCCGAGACGACGCCGACGGCGAGCCAGCCGCTGCTGGCGCCGCCACCACGCCGCCCGTCCAGCAAGGCGG
CGCTGCGCAAGGAGGCCTCGTACGTCTTCAAGTACCTCATCCTCGCGCAGGTGACCGTCTACCTCGAGGCGGGCTCGATCCCGTGCCTTCTCGACTCGTT
CGCCGTTGCGTTCAACATGAGCGTTCAGCAGCAAGGCTCGCTCGGCAGCGTCGTCTACGTGGCGCTCTGCCTCGCGTCGCCGCTCTGCGGCGTCTGCCTT
CAGCACTACGACGCCAAGTGGGTGCTCGGCATCTCGCTCGTGCTCAATAACCTCTGCGTCCTCGGCTTTGCCATGACGCCGAGTGGCCACTCGTACTCGG
CGAACCTCCTCATCTTTGCGCGCGCGCTTATCGGCTTCACACAGGCCTTCCTCTGCGTCTACACGCCGCTGTGGGTCGACGCCTTTAGCCCGCGCGAGCG
CGTCGCGGGCTGGATGTCGTACCTCCAGGGCAGCGTACCGCTCGGCGTCATGTTTGGGTACCTCTTTGGGTCCGTCTCCAACTGGGTCAACGAGGACTCG
TGTGGCATGGCGTGCTGGCGCTGGCCGTTCGTGCTGCAGTTCATTCTCGTGCTGCCGCTCATGGTCGGCGTCTTCTTCGTCCCAAGCGAGCACATCTCCA
TCAAGGCGCTCGACGTCTTCAACAAGAAGACGACCAAGGTACCTACCATCCGGTCGCTCTCGAAGCGCGCGCCGTCGTCGGCGTCGGCGAGTCTTCCGTC
GACGTCGGTGCTCGTACCGGTGCCGTCGCCGATCATCGAGTCGCCGCCCGTGAGCCACCCGCACGTCCTCCTCGAGCAAGCGCCGTCGCTGCGCTGGAGC
TTCAACAACGGCCACCAAGACGAACTCAACTCGGCGCAGCGCGCGTCGATCCGCGCTTCGTACATCACGCCCCGCTTCCGCATGGACTCGTACGACATTG
ACTTGTACTTTGAGCAAATGGAGTGGGATCTGCTGCAGCAGCAGCAGAGCCAAAGCGCGATCAAGACCCAATATGGCACGGTCCTTGAAGAGGAGCCGGA