Description :
From Genome Similarity Track
Location :
contig_134:24259- 27167
Transcript NameFunction/comments
g11599.t1reverse transcriptase

Sequence
2908 bases(100 bases per row)
ACAATATGGTCAGCACATTGGCCAACATGGCAATGGAAGGTGCTATGAGCACACAACTAACGATCAAGGGACGGCCAGAGATGATCAAGAAATATGCAGG
GGTACTTCGTCATATGGGCGAAGACATGACAGGGTGAATGGACAACCGATAAGGTCGCCGGCACGAAGCGGGGAAGCGAAAGCTTGGATCGCACGGAAAA
CGGCTAGCAATCGACATAAGGGCGGTAGCTAGGACGGGCATAGGAAGTCATTTGTTTTACTAAGTGACATCAATGTACCTCACTGAAAACAAACAAAACG
ACAACAACAAACAGGTGCTAGAGGTGTCATTATCTCCAGCGCATCAAGCAGCAGACCCACAGCCACTCAACTGGAGGTTGCAGCCGCACCCGAACGCGAT
CCGAAATCAGATCTTGCTGTACGTTTCCGAGGAATTCCTAAGCCCGGGACACGACTTCATAGTGATCTCACGCGGTTATTACTGCACGACGCCGCACAAC
TATCAACTGTGGTTATTTGTTCAACTGCTTCCTCATCCGGACTGTTGGTATCTCTCCGACGAAGAGTTTGACAACGGCCACTTTACGCGTATTGCAAGCG
GTGCAACATGACGATTGCTTTCGTGATTCGGAACTATAAAGTGCCGGACCACATGAATAATTTTCACACTACTTGTGCTCTACTCGTCTTCGGTCATTAT
TGCCATCAAACCCGCCTTGATAGTAAGTCGTGCCGATGTCGAGCAATATGATCCGCTTCGAACAATCACTGCGTTCGCATCCATACGCTGCGGTTGTGAG
CTCGCCTGTTTCGGTTGCTTTCGTCATACATTCCTGTGCGTTGAGATCATCTGTAGCACCCATAGGCAAGACATGCTTGGGGTTCCTTGATCGATTACGA
CGGTGTGAGTGTGTTGATTCACGTTAGAAAATGCAGGAAGACGATACCTTGGCTATGGCGGAGAAATACTTGGTCAATACGTGAAGCAAAAGTGCCGCCC
GCAACGAAGTTGAAGGTCGCTTCACTACGCATTTTCAAACTCGTCGCTCTCGTCGGTACGATAGTTCTCCTGCACCTTGGAGCAGGGCTGCATGAAGGGG
TGCATGTCGTGGAGGAACTTCCTCTAGCAAGTCTGGAGGTTGTACGGTACGGTAGTTGAGCCGCTGAAGGCCACCGTCTGTACCACCACCTTGTCACTGT
ACTGCAGCGCCTTCATCACCTAGGGCAGCTCGTTGGTTTGCTTGACATCGTCCTTGGTCTTGGCCTCCAGCAGCTTGACATCCGCCACTTGTGTGCGTCG
ATACAATTTTATACTTGGCTTTTGTATGTTAATAATGTGTGGGCCACAGAGATAGAGGTTAAGCCAGAGGTAGAGGTAGAGGTGAGGTAGAGGTGGGGTG
AGGTTAGTTAAGCTTAGTTAGCCAACCACGACAGCTCTATCGTTCACGACCCTGTCATCACGCACTGGCGATTGGGTTGACTTTGATATCATTTGCTGGT
GGGGGTGCCGCACAAAACTGCCATAAGGGTGTCATAAGCAAGCTCTAAATGTGTATCTAAACATAACAGCTTCACACGTACTACATGTATAAGTGATAGG
TTTCGTGATATACGCCGAAGATTATGGTGGTTGCTTGTTGAGGGTAGGATCGCGACCTTTGGTATATCTACATACTGAAATGAAGATAAAATGTATGTAG
TTGCCAAATAGAACACGCGGTTAGGGTCCATACGTGATACCATTAACAGAGAGTCTCTGTAAGAACTGGGCAAAAATAGCTGATTTGGGGGGGGAACTCG
ATTTTCATTAATTCCGGGGAAAACAAGACAGACTTGAAACCAACACAGTCGGAACGACTGGTATTTACAATGTCATATCGCGCTGGCTGCGTTCGCTCAA
CGCCAAATGCCCTCCCACAACAGCAGCGTGAAAACATGCCTCGATAGCATTTTGTATGGCAATTTGTATGGAATTTGTGCAATGGAAGCTGACCTAATTT
TAGTACTCAGCAAATTCATGGTGTTCTGGCTGTGGTCGTATTAGCTACAGACTTACTGAGCTTATCGAGGAGAACGTCGATGAATTGCTCTTCGACGACG
GCAAGCCGTGCTCGGTGGCCAAGACCGCTGACCTGGGTCTCGTCATCGAGACTCTTCGCTACTACGCTGGGTGGCTCGACAAGATCGACGGCTCCGCCAT
ACCCACGTCAAGACCATACCTTTGCTACACCAAGACTAAGCTTCTCAGTGTTTGCGATCAGATTACCCCGTGGAAGTTTCCGTTGCTGCTTACGGCGTGG
AAGTTGGGTCCCGTGCTGTGGGTAACACGATCGTGCTGAAGCCTGCTGAATAGACACCGCTATCTGCCCTGCGCGTGGGTGAGCTCATCGTAGAGACTGG
ATTCTCCAAGGGTGTGATCAATATTGTGCCTGGCGTTTTGCGTCGCGTTGGGATAACTAATTCACGAAGGTCGGGATACTTTCTAAGGAACGATTTAACC
ATTTGCGGTTTGGAAATGATTTTGGGGTAACCTTAGAATTTGCGGCTGGCTGTCGTGTGAACAAGTACGGCAAGCTCGTCAAAGTTGAAATTTGCGTTCT
GTTCAGCGCGCTCGCGAACGAGAATTTGAATGCGTTCTTCATCCTGATCGGTCAGGTATTTTCGGAAAGCGGATGGGAGTCGCGAGGCTAATATTTTCGT
GTCACTCGTCGCCTCAGTGCCGACCTGTCTGCACCATGCTGTCGTGCAGACAAGGATGCGTTAAAGCCATCTTCCGTTGTTGCACATGTAGCTGATCGCC
ATGTAGCTTCATCGTTATCTCCCACGGCAAAATCTTTTCTGGTGATGCCAAGACCGCGCCACATGAAAGGTACACAAAGCAGGACATTGCGACCCGCTTC
CACAAAAA