Description :
From Genome Similarity Track
Location :
Scaffold_3:2425710- 2428171
Transcript NameFunction/comments
Phyin_T30-4PITG_02524Putative uncharacterized protein
Phyin_T30-4PITG_02525Elicitin-like mating protein M25
Phyin_T30-4PITG_02526Dynein heavy chain

Sequence
2461 bases(100 bases per row)
CCGCCAACAAGTGGGAATAAAAATCAGCAATGTTTGAATTTGGCTGTGGAATAAAAAGCTACAGTAGCTACTCGTCTTGGCGACGTTGGACTTGAAGAAC
TTCTGGTTCTTGGAGAAAAAAAGGAATTGGTGATTTACGGCTTGGGCGATGGAGTGGCCTTGTAGGTCGTGTTGGGCATCGGAAAGAGTTCAAGAGCCGT
GCCGTTCATCGGAGGCTTCAGACCATCCGCCTCATTCGCCTTCTCGTTGTCAGCACAGTGAATCGGGTAGTGTTTATCGTCATGGTCGGTCTTGACGATC
ATCGGCTCGTCCAGTCCATGGTGGTCCTTGTCACCCGTGGGCTTTGGCGCGGGGTAGTGCTTGTCATCCGTGGGCTTCGGCGTCTTCGAGTACTTCTCGT
CGGTGGGCTTGCGTGTCGGGTCGTACTTTCCGTCGGTCGGCTTTGAAGTCGAGTAGTGTTTGTCCTCCGTTGGCTTTGGTGTTAGGTAGTACTTCTCATC
TGCGGGCTTGGACGTTGGGTAGTGCGTAGTCGGCTTCGCGGTTGAGTGGTGCTTGTCGTCTTCGTGATCCTTGTCCTTCTCACCATTGCAAGCGTCTTTG
AAGGCACACATTATCTTGTACGCATTCAGCTTGACGCCGGCGAAAGACAAGTAGCAATCCGAAGGTTTCAGTGCGAGGACGTCTTCGATCAGCGCACGGC
ATTCATAAGAAGCACACATGGCCTTGACCTGTGGGTCTGTCGGATAACCTTTTGGCGGTGCGATGGAAAACCCGGCCGAAACCTTCTGGCACGGACGCAA
GTGCTCGTTACCATAAAGCTTTGCGAACTTGACGACTTCAGTCGAAGAACAGGCATCTTCTGCAGCAGCTACGAAGGCCGAGAGCAGGAAGAAAAAGAAA
ATGCCGAACAGCATGGTCGGTGGAGTGGTCAATGCGGAGAAAAGACGAGGCTTGGAAGTGCTCGGAGACGGTGTCTGGGACTGGTTACCAGCTAGAGAGC
AAATTGAGGAATGAGGAAGCTGACAGCGAGAGCTTCTCGCTTTGATCTGTATGAGCTATTAGCTTTCTTCGAGAAAGGTCGACACCAGCACAACCCTCGA
TTCTCTTGCAATCACAACTTTAGAAGAGACACAGCTTCAAAGCACTAGGAAGAGACAGATTTTGTCGTTTTTATCCACGTCTTAACCAACATACTCAATG
TTTAGAAATGCAAGCCCCTTCTTGGGGCATCAATCGCTTTAATGTCACTCTTCACTCTAGACTTGCAGCTCCCAGAGCACAAGAGCTACCGACCGCTGCA
CCCACTTCGTTTTCGGGAAAGCGGCATCCTCGACATTCACGGCCACCGAGAAGAACAGAGTTTCGCGCTTGCTGTTCGAGTACACCGGAAGCAATCGAAG
GTTGTCCGTCTCCTCGCTCTGCGGGGCCCAGCGAAGATGCAACGCTGACAAGCTGTTGCGAATCTCATTAGACGGCGCAAAACCAGTGAAGTTCCAAGTT
GCACCTTCCAGTAGAAGGCCACGAGCGGTAAAGCCACCGGCAGACGAAGTCGAAGGGTCCTCCACGTCAGCAAGGAGATGCAGCTCGTCCAGCGAACAGC
CAAGATCCGCTGCAGCACTTTGGCGTGCGGCCGTCACGAACGCTTCAGGCGAGAAGAACCCACCGAGCCAGATACCACCAGGTTGCTGCAGAATCTCAGT
CGGATCCACTTGCGACAGCGCGTTCAGCTGGTGCACACGTCGAGAGAAGTCTGTGAGCCACTCGCTCAAGCTAAGCTCATCCGAGACACGGTACAGTTGT
GCCCATTGCTGAGGCACGTGCTCCCGGTACAGTGTACGCATGGCCTCGCGCGTTTCATTCGACGGCTTCGCCTTATACGCACACACCTGCTGCACTGTGC
GTAGCAACCCAACCACGTCACTCAGGAACTTAGCGCCCAGCTCCAGCTCACGGAACATACAGCGGTACACAGGGTTGCCGAAGTGCACGGGGTCACGGAC
AGTGGGCACAGCAAGTCCCTCCGCTGGGAAGAGCTGCAACCAAGCGCCAACACGATGGTCCAGATCCTGTACCCACTTAGGTCGGGCATCTCCGCCATCA
GCAGTAGCCGTGCCCAGCACCATCTTACTCTCGTCATCTGCAGCAGTGCTATCGTCTCCTCCTTCGCTTCCGTAGAATTCCTGCATCACCTGCAAGTTAC
GCAGTATGCGGGCACCCTGGTTAATGAGCACCATCCTCTCCGCCGATCGCGGCAGACCCATCCACGACGGTGGGTTCGTAGTCGGCAGAGCATGGACCCA
GTCCATAAACTGCGCCTTCGTCTTGCCCTCAGCAATCACAAGTCCAGTATCCTTGCCTTCACCAGGCGGCACGAGCTCGAAAGTGTTCTCGTAGCTGGCA
GCAGTGAATACATGCTCTAAAAGCGTGTCCATCAGTTCCTGATCGAACGTGTTGTCCACAC