Description :
From Genome Similarity Track
Location :
scaffold_442:24249- 28306
Transcript NameFunction/comments
g8409.t1 hypothetical protein PHYSODRAFT_311566
g8410.t1 conserved hypothetical protein

Sequence
4057 bases(100 bases per row)
TGCTGTGCAAGACGGACGTGATCCCGCTCGCGTCCAACGCGCAGGAGAAAATCGTCGGCTACGTCGCCGTCATCATCAACGTCGCGCTCTACGCGTCGCC
GTTGCAGACGATGAAGCTCGTGCTGCAGACCAAATCGGCCGCTTCGCTCCCGGCCACGATGTGCTGCGTGAACCTGGTGAACGGCTCCCTGTGGGTGCTC
TACGGCATTTTGGCCGACGACATGTTCGTGCTGACTCCGAACGCCTTGGGCGTCGTGTTGAGCGCCGTTCAAGTGTTTTTGTGCATGAAATTCCGACCAA
ATGGACGCGTCGTGGAGGCGCATGACGCTATCGTCATGGACGCCAAGTGCGACGCAGTGGCGCTGTCCCCTTTGCCTATTGACGTGGTGAAGTCTCCAGT
CTACCAAGCGGCCCAGTCCCCAGTATGAAAAGACCCGCGGGACGCAGAAATCGACCGCTATCAAGACGAACCATCCTGGAACCGTCAAAGGTTCCTCAAG
TTACCGTCAAATGAGTCAACTCAATTGAGTCGAGTCAACTCATCTTCGGCAAACACTTTTAACCTGTGTTACGGCAAAAGGAAGTCTGTAATACAGGTTC
AACTTCAACTTCAACTTTACATTCATTTTTTTGATTTGCATGGATTTCATTGTTTTTATTGTTCTCTGATGCATTATATCGTAGCTGGCCCACCAGCATC
GATTTGTTGCGAAGAGGAAGGCCGTTTGGAAGGAGCAAGACAATTGGACAGACGTTTTAGTCGATCTCTAGCATTTTCAATGAACGACAGCCTATTTGGA
CTAATACAATACATGCACTATCATCCAGGCGCGGCCTGGTTGTTGCGGCCTCACGAGCTGAGTGCGTCTATTACCATCCTCTGCGTCACCAGGTTAACCT
CGCACCTCGCCATCCAGGGTTTAAATACAGCTAAGGCCTGTACAAGTGAACCGAACACAGGTTATCTGAACTGAAGATGATCTCACGGAGAACGCACGCA
TCATACAGTACCTGCTCCACCTCCACTGCTCGTGGAGAGAAAAGGATGGTCAGCGCGAACACGAGCGACTCGTACGTGTGCTCCTGCCACGTGAGCGCCA
GAATGACATGACGGAGCTGCTACGTCGTCCAGACCGAATGATTAGCTTAGTGGGAAAAAGTATAAGTATTTGAAAGATCGAACCTTGTGGCGAATGGCCT
CGGAGCTCGCGAGGTCCACGAGCAGACTCGAGACGTCCTCAGGGGCCGAGCACATTAGCCAGGATGCCAGCAGCGGAACAATCTAACAGATTAAAAACCC
AAGGTTAGTTCGGATTTTTTAGTGACAATAATACCTGTTCTTCGTACGGTATCTCGGCTGTGTCGCGTGGGGAAGTCGAACTTGGCGCTATGACGGATCA
GCACTTCCATGATCTCCTGGTTTGCCGGCATTTTCACAGCCACGAAGAGCGGGAATGGGTGCTTCAATCACAAATAACCCCGCGTCAGTGACAGTAGACT
TTTGGATTCCAACTCAAAACGTACGCCATCGTCGCGGAAGAAGCTGAAGCTGTTGTCACAGTTCTGAAGCACGTCCATCTTGATAAACGGGTGGCTTAAA
ACGGCCGCACCACTCGCGGCTTTATCGACGTCGGCACTCTTGTTCTCTTCGGAGGCGTTTTGTTGCAGCAACATCTCGAGGATCTCTGGACGTCCACGAG
CACAAGCGACTTCCACTGCGTTTTCTCCCATGTCATTGGTCCAGTCCATCGGAATTCCTTTATTAAGTAGAAACAGAGCGCAGGAGGGAGCGTTGTACTC
CGTTGCGATGTTGAGCAGTCGACCTCCTAACTGCAGTTCACAAGACAAACGTTAGGAAAGGATACTTAACCCTCTACAGATGGGATAATATCTACCTCTT
CGCCATCCGCAATGGACATTTTATCCTGAACGCGGTCATACAACGCCTCCAGTATCCCCGCGTACTCGTGACGCACGGCCATCACGAGCGTTTTATCCCC
GACAGACGTCACTAAACCGGGTGAGCTCTTGGCCAGCGCATTGACAATATCCGTGAATCCGTGCTCTCCGGCAATGTCCATGGCGCTTCGGCCGTCCTGA
TCTTGGGTGTTGGCGTCTGCACCGTGGGCCAGCAGCTTCTCCACGTGTTTGATGAGTCCGTACTCGGCAGCATTCAGCAGTGCCGTGTCCCCAGACTACG
AAATCTGGAAGTTAGTTTGGATATTTGGAGCTGGAAAAAGAGTAGGGAACGCTACCTCGTTGGACTGATCCACACAAGCGTTATGGTCCAGAAGCATATC
CAACACACTGGTATCAATGTCGCGATACGCGGATCGGTCTTTTACTTGTTGACGTTTGGAAATAGCCAGCTATCAGGCAGATAAAATAAATCGTAAGACA
ACGTATTTTAAAAAGGAATATCTAATACCTACCGCAACTGGGGACTGGACGTCGATGCAGCGTGAACGCAGCAGTAGAGTTGGCCGCATCTTTTGTAAGC
AGATGCGCATGACGTCGATCTGCAGTGCTGTCATACCCGTCTGGATAGCACTTGTTAGATATTTTTAAAAAATACTATCGGGTTAATCCCTACCTGGTCC
TGCAGCTCAATGTCAGCTCCATGGTCAATTAGAAACTGGACAGCAGCACTTTGTCCTTTCCAGACAGTGAGATGCAGGGCTGTGGATCGCTTGAACGTCT
TCAAGTTGATAACGTCGAACAAGTCGTTAGTATTTTTTTCGTTCTTGTTTTGTCACTTAGGCACAAATCTAGCCAACCTGATGGTGAAGTTGTGCGTTGA
GCAACTGCGAGTGACTCGTCAGCAGCGACTGGAGCGCAGCCACGTTCCCAGATTCCGCTGCGTCTACCCACTGCTGCTCCACGTCGGAGTTTACCGACTG
GGGCGTTGTAACTGGACGAATTGACATAAGGAGCTGCTCGTTGCGTTCGTTGCGTTGCAGCAGCGCGCTTGGCTCTTGCAGCTCACCGCGAAGATTCTCG
AATGAGGCGGAGCGAGCCGAAGCCAACCCGACGCAACGGCTCAGTGGCCGGCGACAGTCGCAATCCGACCCCCGGAAGCAAAACCTTGCGACTGCCGACG
CATGAAACCACAAGACGAACGTAATAATAAGCATCAACGCCAAAAAGTCTGGAGATTTTTAATCTAGAAAAAAAAATCTTCGAAGGTAAACAAACACAAG
AGAGATAATCCCAGGAGAGTTGAGAGTGGCAACAACTGATTCAGAGCTGCTCTGGACCACTGTGAAAGCTGATTGGGCTCCTATTCATTCACTCCGAGTG
AGCCATATCTAAGCTTACTTCCCAGTACATGTACATGGTACGAAGATGAAGGCCGTTTCAACCGAAGAAGCTAAAAAAAACGCTCATGCCCGCAACAAGT
TGCGCTTTGTCATCGAAGTAGGTTGTTCCCTGAGTTTTCATTCCCCGTATCGCGCGTCCTTGTTTGCCGAGTAACGTGTGGGGCTACAGTGGCAATGTTC
CGACAACCAGAGTGCACAACGGTTTACAACTTTCCAAACTGAAATGTGTATTTATGAATACGGATAAGTCTTACTCGTAGCCGTCGCCAGTGCTGGACTC
TCACCCGCAGTGTTGCTAGCTACAACGCGAACGGCGTATTCGCGACCGGGGGTCAAGTCCCGGATTGTATGTGCACGTAACTCGAAGCGCGCGACACGCG
CCACGCTTTGGCCTCGTACGTCTTGGGCAGCTCTCACGCCCCGCGACCAGGATCGTTCGGGTCGACGTGGATCACGTTGCCACTGATACTCGACACTTTC
ATCACGCACCGCTGCGTCTTGCTGGACATGCTGGTGGTGGGGCCGTCGGCTACAATGAAGTACTCGTAGGCAGCTAACGCCACCGCCGTGTTGAGCGTCA
AGTCGTTGTTCACTAACTTCTGCGCGCAGGCCTGGCGCGCCGAGAAACCACTGGCTAGAGTGGCCGCCAACCAGTCTGTCATCGCCGAATACACGCGCGG
GGCCGGCGCGCAACGGTCCGGCCGGTCCAGGAAGCTGTTCCTGGTGGCCAACGTCTG