Description :
From Genome Similarity Track
Location :
Scaffold_788:2424- 4742
Sequence
2318 bases(100 bases per row)
GCAGGCGCTCATTCTGCCAACCTTTTGGAAGACCTTCGGGTTCATCAGTATCCCAGTCCTTTTGGTCGCCTTGATTTGCATCGGGTGGACGACTTGGCTC
ACAATCGTCACGCTTGCACCGAATCAAACCGCCAACTTCCTCATGAACACGGACGAATTCGACGACGGTCGCTTCTGGATGCTGCTCGAACAGAGCACAC
GCATGAAGGTGGCTGTGGTCGGCGCACTTGTGGTCATCAACTTGGGGTACCTGCGCGGTCTGTTCAAAGTGCTGCGTCACCGACCCAGCAGGCGCCAATC
GAAGATCCAGGCAATAGAGTACCATGTCGACGAATGGCTCAAAACACAAGAAAGCCATCACCTTGCCGGACAAATAGCGCGCGCAACACGGTCGCTACTG
CAATCGTGGAGAGACTTGACGAATATCCGTGGCCGTAATCGCAAATTCTGGGTATGGTGCAAGCCTATCGATTCCGTTTTCTGCGTGTCTGTCGTGATCA
TCGACTAACATTCGGCTAATGTCGTATTGACTCACATGTTGCAGAATTGGCTGCTAAAGCTCGGGGATTTAGCCATGCAGACGATCGCAATTTACCAGTT
TATGGAGAAAGGCGCGCCATTGCCACTGCTGCAAGGCTACATTGCGTTTGTGGCTTTTCACTCGGCGTTTTTCGCACTCGTGACGCTCGCTCGCCGCCAT
ACAGCGCTCGAAGAGATCGTCATTGACAGCGCCTTCGACCTGTTCAGCACCATTGCTGTCCCAATTCTGGTGCTCCTTTATGCGTATTTCAACTGCCATA
TCGATTTCGAATCATCCCGAATCTACAACGAGTTGATGCCCGAGGGTAGCTTCGAGCGATCGGCGCGAATGATGGCCGACCCGCACGAGATCGCGCTTTT
CCGCTCGAGTTTTGATGCGCTGCGGATTCTCTCAGCTACCGATTTGTTTCTCCGTGTTGGCATGAACCTGTTTTTCTGCTACCGGTTCAATCGCATGATT
GAAGAGCTGGAGCGACAGCGGACGCGGCGTGCAGTAGTGCGAATCATCGTGAACCAACGACCCGTGCCTCGGATCGCTGCTCTGGTATTCATCGCATATG
GCTGCGCTATCACAGTGTATGCATCAATGAGCATCTCGGCGTCTCGTGCAGCGTGCTCCGACTATCCGCAGTGCGTCGAGTTCGCCTACCAGCTTGCCAC
GAACGATGGTTGTCCTTGTTTGACGCTAATTGATGCCGAGCGTGCTCCGAAGACGTTTGACGAATGGTTGAACCCTCCGGATGCGACTGGCAACGTCCGG
GTGTTGGCTGCTTCTGGGAAACTACGGACGCTCCAGCTGGTGAATCGTAATTTGGAAACTTTGCCGGAAGAGCTTCGGCGATGCCAGCACCTCGAGAGCC
TGTACGCTGATCTCAATGATGTAGCAACCCAATTTTGTTTTCGTCTAATGTGGTTGGTGATCACAGGTACTTATCGCACACTGGCACACACGAGCTTCCT
CCATGGATGCCGACGTTCCAGCACCTGCAGTATTTGTAAGTAGGTGCCATTACCGCTAGGTTCCCTCACTTAAAGTTTGACGAGCAAACGTTCACGACAA
TTCAGGCAAATCGATGGACGCTACGGCGGCCCGACACTGCGTGAGCTTCGAGACGATCTGTTCGACAGCTTCTCGTCACTCATTTTCCTTCACATCAGCA
TCCACCCCGAGCTGAAGCGCGTGCCGCCACTCGATGGACTCACGAACCTCCGAAGTGTCGCCTTCGCGCGCATGTTCTCCATGTCTACTCTTCCGACATT
CGACTACCTGCCTCTTATCGAACACATTACGATATCTTACATGCCACTTGTCCGCACGCTACCGGAACTCGGCCATCTCTCGCACCTGATGCATTTTTCA
CTTTACCGCCTGAGCTACGCATGCTGCGACGGGTTTCTCGGGGTATGCAATCTCACCCACCCATTTTGTGCCGGTATTCCCAGCGCTGGTGTACCTGTCG
CCACCTGCGTCGACCCTGAAACGGAGCGAGCGTCACGCGAGACAATGGCAACGCTCAATCGATTCGCCAGCTCCGTGTGTCAGCCGTCCAAGGTCGATTT
TGCGTCGGACTTTCCAAACAAGGCGCGAACTGATTTGTGTGGGGGTGTGCTGTACCGCTCGTGCCAAGTTGGCAACGCGACCGGGATGTGCTACAACAGT
CGAGTGCAAGTGGTAGCGTGCACAACCGATGCCAATAAGATCAAGGTTCGGAGACTGCAGATTGTTCGCGGTGTTGGCTTAGCCTGTGACCCCGTGGAAG
AAGAATGGCTGGGATGCA