Description :
From Genome Similarity Track
Location :
Scaffold_27:242354- 245847
Transcript NameFunction/comments
Physo_133653hypothetical protein
Physo_156792hypothetical protein

Sequence
3493 bases(100 bases per row)
CATGGTGAGTGGTGGCAAGGCTCCTCGACGCGGCGCGGCGCAGCGGCGCGCGCGACTGCAGGGGGCAAACGCACTGCTGCAGAGCGGCCCGGACAGTGCG
TACCCGTCCTCGCGCCTGCTGGTGTGGCACTCGCGCTTCTCGCACGAAGCTTCTCGCCATGACAGCGTCGTCTCGGGTCACGCCTTGAACCAGCAGATGG
AGGTGTATCTGCCTGGCAAGGCCGGGAAGGCCGCAGCGCAGTCGCTACAATGGGAGACGGGCTTTTACTACGAGGTCAAGGCCTCGGTCGACATGTTTCT
GTCGCCGGCCTTCATCCGCGAGTACCTGGCGGACGGCGGCGCCGTGTTCATGGTGGCCAAGAACGCGGCGGTGGACGCGTCGCAGTCGGCGATGTTGCTG
CCGTCGGACCAACTACTGCTACTGGTGGACACGCACACGTACCAGCAGTTGGGTATTGTGGGTGAGAAGTACGGCAAGGCGGTGCCAGCCACCTGCAGGT
CGACGCGCGGACAGAAGTACGTCATTACGCTGGACTTGACGTCGTCGACGTTCGCAGAGGAAGGAGACAACGCCTTTAGAGATCGAGTGAGACGGGCGTT
GAGCTCGAAACTGGAGGATCTGGAGATGCTCATGTGCGCGTACAGTCAGCGCGGAGCGGCGAGGACTATATTGTTCGGGGACGATGACACGGTGCCGCGT
CAGCGCATTGAGCTGAACGCGCAGATGACGACGCTCAGCGAGGTGTTTCTGCCCAAGTTTGACGCGTTTTACGCGCAGCTTGGTGGGAAGGAGGAGCGTA
ATGAGGACGATGGAAATAAACTGAGGACGTCGCTGCAGGAGGCCTACGACTGGCTGGGTCTGGTGGCATGCCGACTCACCGACCTCTTGCAAAGACAGAA
ACTGGAGGAGTACGTGTCGACTTTCACGGGCTTCCCCGACTCGTTCGAGTGCGAACCGGACAGTGAAGTGACCACGGTGCGATGGCGTGGCCTGCTGGCT
GCTCCGTTTTGCTCCACTATTGTGGAAAAGGTGCAGCGTGCTGTCAAGAACGGTGAAGTGCCGTGGGGTGCAGTCACGGTTTGGGGCTTCCCGGATGTCT
TTGTGTCGTGGATGCAGCCAACCAAAACGAAGAGCAGCAAGGGAAAGAATGAGCTGCAACGACGAGAGCATGGTTACCTAGGGAACGGCAGCAACAACTA
TACCCTGCTCATTCTGCCAAACGATGAGTACTTCCTGCTGCAGGCTCTCGGGCCGCACGACGCCACGGTGTAAGAGGCGAGTTATCCCCATGAACCTCGG
GAACAATAGAATAGAACGTTGCACCATCGCATCTCGTTTCTTGTGCATATTTTGTTGCAGCCAGTACTCTCTAAAGCTAGTTAGCGAGGACGTTCTCCAC
GAACGCAGCAACGGTGGACGAGTTGGAGTCACCTCCAGCTTCAGCGAGAGTAACAGCAACCTTGATGTGCTTGCGCGCCGGCTTGACGTTGTTCTTTTTG
CCGTGGATAATCGCAAGCCGCAAGTTCGCCAAGAAGCACGTGGCAAGATCGCTGTTGCTGCTCAACGCTGTGGTAGTGCTGCTCACATCGTCATCGCCTT
CAGCTGTACCAGGGGACTTGGTCGCAGTTAAGGAGGCAACAAGCTTCCACACGTTGATAGCGGCATCCAGGAGCTGTTCTTCTTCGTAAAGCCCGCCGAG
CTCAATGAGGATCGGCACCAGTCTGCTCGACGAACTCTCACTAGCAGTTGCCGAGACATCAGCAACTATGCCCAGATATTTTTCGAAGGCCTTAGTCGAG
TTCGAAATCGAGAGCAGCCGCGCTTTCAGCAATTCAACATCCACAGAGTGCGCCAGCACACCGCTCGCTTCAGCTGCTCCGAGACGCTTCAGTGCCTCAT
TCGAGACAGCAGTCGCCTGGTCCCGTTCGCCAAGCTTGACGTAGCTGTAACTCATCAGCAGCTCCAACTGAGCTGCGTCGTACTCGTTTTTGCTAGCAGA
AGCAGCCAGCGATAAACCGGTTTGCAATAGGTGTAGCAACTGGCGAAGAACCTCATCGTGAGAGGCCTGCTGTGCTTCGAGCCCAATGCGCTTGAGAATG
CTTGCGCCAGCCAACAAATAGGCCTGCGTGTTCCATGGTTGAGCACGGATCAGCTTCTGCGCGTCCAAGCACAAGCCTTTTGCCCCAGATGGACCCGCCT
TGAACAGTCCCAGCAACGCGTCCAAGTAGTTGCGGTCCACAGTCTCATTGCCGGGTGAAGGCACATTCTTAGCGCCCGAACGCAAGTACTCAGCAAGACA
ACTCGACACTTGAAGGTTCTGCGAGTCGATCGTCGCAAGCGCCAGTCGCATCCACAACGTACTCGAGTTGGCACCATCGTTAGCTTGCGATAACGCTTGC
AAGCGCGACAAGTAAGAATCTTCAACACCAACAAACCGTTCGTGAAGCTCAACCAAACGCAGGTTCAGATAGTCGCGCGTTGTCAGAGTCGACTCCGCTT
GGTCAATCAACGACAAGAGGTGCTCCTTACACACTGTCGCGAGATCAGTGGTCTGGGAAGTAAACTTTTTCATCAGTAAGCTCGCCATCGATAAACCGAC
GAGGGCAACAACCTCGCTTTCCGCGGATTCCGAGTCCTCTTGTAAGAGCAACACCTGCAGCAAGTTCAGTGCCTCACCCTCCTTCGACTGCCGGTACAGT
ATCTGGGCTTGCACAATGGCTTGCAGCGATGCAGAAAAACCGGGTGTCGCCTCAACCGAAGCAGCAATTTGTTCCAGGAGTGCCAGCTCGTCGACGTTTG
CATCATGGGTTGTGGCGGACAACTCACCCAGCTTTGTCACCAGTTTGTTCCATTCGAGACCGTTGGGCGCCTGTGGCGACGAAGCCGCACGGGTGTAAGA
CGACAATGCTTCCGTGTACAAACCAAGCCGATGTTGTGCGACACCAAGTGCGTGCCATGCGCGTGGGTTGAATGGATCCCGTTCCAGGTACTTCTTTAGA
TAGAACATCACCTGTTCATTGCCGTGTTCCGGTGCTTGAGTTATCGAATCACCAACGCTTGTTCCGTAATCAAGCAACGCCATGCTCAAGCCTAGCAAAG
CGTCCAAATCCAACCCGACCTGCAGCGCACAATCGAAAGCTTCAATCGTTTTCCTTTGCTGGATTGTGGAGCTAGCTTGGCGGCGAGCGAGCATCGCATA
CCCATTCCACATCGACGGGTTGCTAGGATTCATGCTCTGTAACTGAAGGAATGACTTTTGCGCCAAAGAGGCTGTCGACGGTACTGAATCGGCTTGGCTG
AGGTAGAACATGCCCAGGTTCGCCCACGTGGCATCACTGCTGCTTCCAGTTTGAATTGCACGAGCCCACGCAAACTGCTTTACCAGCAGACTGTCGGATA
CCAGCGCCAGGCCGTTCCACGCCAGTGAGCACGAAGGATCTTCCTGAAGGGCCAGCTTGAAATTTGTTGCTGCTTTTGCTTTCAACATCGCAA