Description :
From Genome Similarity Track
Location :
Scaffold_281:24226- 34399
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_281-snap-gene-0.17GF11137

Sequence
10173 bases(100 bases per row)
CTTGGACTGATGCGTGGCTCGGCGACTATGAACAGCAGTAGCACGACGTCCACGGCGCGAGATGGTCATGTTCGAGAGAAGTGGGTTGGGTTGGTTGCTC
ATCGGAGCGCGCCACGAGTCAAGCAGCGAATAGCGTCTAGTCGAGCTCATTTCCGACCCAAGCATTGAATGGAGACCAAGGGATACCATCGAGGTATCGG
TTGCATTGCTACCATTCACTACGTGAGATGGCGCTGGAGTAGGAGCTGGAGGGTCTGTCGCCGTGGGGCGCGTTGGTGCAGCTGCTATTGGTGGTGTTGG
TGGTGGCGGCGGTGCAACTGGTGAAGGCAATGGTGATGACTCGGGCTCAGGAGCAATCATCTCCATCGCAGTCAAGCTAGCTCGACGACTACGATCGACA
TCAACTTCTTGGCGGTCGTACTGAGCAGCCTTGCTGGAGTGGTACTGCGAGTCGATTGGTTCGTACGTCGCACGGATCATCGAAGCACGAGCGGGTGGTA
GTGAGACCTCGGTGTCGTTGTTTtGTCTGTTTACGTATCGGAAGCTGGCAGGGGCAGGAGCCATCTCTTGGATAGTTTCTCCGTCGAACATGAGGCTACG
CGGAGGAGGATCGACAAAACAAGAATCCACTGCACGTTCTTTGTCGACATCGAATGTGCCAACGGAGCTTCGTCGCGCTTCGTACTCGCCATCAACATCG
AAGCTGCGGTTCGTCGCATTCTCAGCATCAATGTCGAAGCTACGGTCAGCATCCACATCGAAACTCTCACGGAAGTCTCCGACCAAAGACAGACGGATTT
CTTTTTCAGCTTCAGCTGCTTTGGtCTCAACAAGCGTGAAGTTGTGCCAGCGGGCACTTGCACGCTGGAAGAAGGATTGTGACAGAGGTTGTGTGTCACG
AGCATCCGCACGTTGTTCAGCCTTAATGATCCGCAGGATTCGGTTCACATTTGAGATGACATtCGAGTCGAATCCATCCTTCTTCGCAGCTACACCTTCC
AGATACGTCGACATTGTCGCGAAGTAAGCAAGGTCCTTCAACGCAAAAGACGTTTGAGTTTCATCGTCTGCTTGGGCTTGTGCTCGAGACTCGAGGATTC
GGCGCACCACCTTAACAAGAGCAGGAATGTCCGGGTGGTCAACAGTGATTCGGCAAAACAACAGCTCGAGAAATCCCTTTGACTGCATAAGGGGgAAGTG
TGCCAACCGACGTGCAACTCGCAACGTGCACCGGTATGGAAAGCCAGCAATCACGTTCTTGTTACAGTGGCGAACAAGTTTCATCACATCTtGTGGCATC
TCAAAAGCTTCGATACTTGACTCAATATTGAGGGGAAGTCGAAGGATATGGATCATCGCAGACGTGAACTGCTCTACTTCTGTTGCCAAGTCACGTAGAA
ATTGAGGAGGGTTTTCGAGGTCAAAACCCATCAGGCAATTGATCTTGTCCTTCCACTCTTGGAATAACAACTCGAGATTGTAAGCTGGATTCGTGAGGTT
CTCTGGGTCAGGTCGAGCGAGGAAATTATCCAGATAGAGACCAGCGATGAAGTTTTCCGGCATGTGAACATAGTCATCCTCGTCGAGAATTACCGAGTCC
CGTTTGATCTTCGATCTTTCGATACGGTTGCGACAGATCACTTCATCAACCTTACCTCGTACCTCAGTGCGCCAGTACGAGTTCCATATGAGATCACTCT
TATCGTGATTGTCGTCAAAGAATTTCGTTGCCATGCTTGGATCAAGATGGATTTGGTACACGATAGGGTAGGGTAAGAACCGTCCAaGGCCACTATACAT
GCTCTCTCTGATCGAGAAATCCTTCGTCAGTAATGCGTACAACACCTCGAACGCAGGCTCTCGTAATGCCTCTGCCCGCAAAAAaTGTTCGTGAAGAACG
TGTTGGCGAGATTGAATAGCAATACCGAGAATTTCAACCCACAATCCACTCTTTTCGACATATTCGGCAACAACCAAGCATGCGTCACAAAGTtCGGCCA
AGCACGATAGCGCATAGTAAGCCTGCTCATAATCGAGATGATCAGCAATGACTTGCAGACTCCACGTGAATCGGCAAAATGGAGCAAACATCTTGTCGAG
ATTGTACTCGAGTCCGCATATCTTGTTCAATACGAGTAGAGCATATTCTTGGCGATTCAGGTAGTCAACATTGCCAAACTCACCCTCCATTCCTGGGGgC
AAACCATCCAAATCAGCATTTTTCCCATTCTTCGACATGAAGCCGTAGCTAGACAGCGACCGTCTAGACGAGATAGACATGCCACCCTTAtCTGATCGAT
CGAATGGAAGCAGATAACGGCCTAGTGTAGCAACCGAGATAGGTTCGTTTtCGCAGTCATCAAGATCTGCAAACTCTTCCAAGGCTtCCaCAAAaGgCTC
CTGAAAGTCATGGAGATCCACTAAAaCATTCAAGCATTcAAGCGCTGGGAgAGTATCGGCATAAATGCCAAGGGTTGGgTCACGGTTCTCGTTCAAAAaC
aTGAAGAGGGCCTCGATAAGCTCGCGAGGGgTCTtCGGATAGATGCATTCTGCTGTAATGCTATTGATGTCACTCTTCGCCTTTtCGAGCAGATTACGTA
GATAGATTCCACCCACATATGGCTCGATCTTGAGACAATCATACATGTAGCTTGTCGAACTTTCCAGAAAGAGAATTTCGTCGTCACCATGGCTGCAATG
ATCTGCGATAAGCTGCATCAACTCACACCTCGTACTATTGTTCCAAATACATGTTGGCTCTCGAATGTCGGTAGACAAAATCATCCAAAAGTCATGTCCA
CTTGGTCGATCAAGGCAGTCGAGGAACTCCATCGGGAGTAAGTTAGCAAGCGCATCTAAGCCTTGAGACTTCGACTGGCCATCACACCCAAGACTCAGTG
CTCGGAGTGACAAAAaCGCTGCCTCAACAACATCGCGCTCCTTCAAAGCAACGATCCCGTCGGAGAGGCTATTAAAGGATACTGGACCGCGCGCAACATC
TTCTGCTGTGTTCAGCAGCAAATACAATGCTCTCCAGAAGATTTTTGTTGAAACAACAAGCTGTTCTTGAAGGAACCGATTATTACACATCGCGGTCACA
ATGTCAAAGAGAAGTTTTTGAATCTGCCAAGGCTGACGATCTTCAAACGTAGTCAGCAGTTTCTCGAGGAACTTGCATAAGCGTAATGACTGCTCAGTTT
GCATCAACTGAGACTGGGAGTGAAATGTCGGCCCAGCAAACAGCAAAGGCACATCGTCGGTAGTCTCGTCACTAACATCTGAATCAAGTCGTGCTGTGAT
CGGAGGAGTGGCCTTTGCATCGATGCTGTTCCGCAAAAGCGATTTCGCGCCATACTCTGAGGCGACGAGCAGCTCGAGAATCCCGAAAGCAGCGCGCTTT
GAACTGAAATCATCGACCGAGCTGTATGCATCAAGAACATCGAGTAAAGTGTCCCAAGATCCAGTCAAAGACAGAAACTTTGGGATGTTCAGTGGTGCTG
ATGATAGTAGTTGATAGAGGATTTTCACGCACAGGTCACTGAAAACAGTCGATGAAGTGTCCTCGGACGCCTTCATCGAGATCGTGTCCAGGAGCAACTC
CAGTGCCTTTGACTCGTACGaGAAAAaTTGGAAGCTGAACTTTTCCAGGAGTCGTAGCTGCGCTTGCAAGATACACTCAACAACTTCATCTGACGTCTTC
CCAGTGCTCAGTTCAACCTTAAGTTCCAACAGACTGCTTAAGCGGTCGTACGCAGAACGAACTGTTGCGACCGCGGCACCTTTTTtGCACAGATCACGGT
AGCGAATTCGCAACTCGGTCATGTCATAGCTGTTGTCTCGACTCCACCCAAaTGCCTTGAAAGCGGCAACACTTTCCGCTTCTGCCCcTCCCAGCGTAGC
AGATGACTGGCGCTGCTGCAGTCCTTTCCATTTTTCTTCGATTGCACTCATGAGAACTTGTGGCTCTTCAATTGATTCGAGACTCGCCTCTTCTCCTTGG
GCAATAGTAGACAAGAAGTAACCACTGCAGTAAACATCTCTCGACAGCTCCAAGTACTTTACAGGAGGGAGTGATACGTAACAATACGTTGCGGCAACAT
CTCGCTTTAGATCTTCTTCAAACTCTTCAATGTGCTCCTTTACTGTCTGTCGAAGATGTTTTCGCATAGAAGCCGACCAAAGCACACGCTTATCAGTAAC
CCGCCCCATGAAGACATCAGCAAAGTATTCAGGAGACTCAGTATCAAGGATGCAGATCAGAGTCTCAGGCAGCATATCAAGAAGATAGCTTTGGCCGCTT
CGATTCTCATGATTGTCTTGGACGCGGTGATACATATGCAGCAACCTTGCTTCTTCCACGAATGTTGATCCGCGAGCAGAATCCCAGTCAGTAGCAAACA
CGAAGAAGAAGAATCCAAAACGGAACAGCTGCGGACCACTAGCTGGACCTAGCGACAGCAGAATCTCGCATGCAAGTTTACGCGTAGCGACGTCGTCAAC
AACCAATAGCTGGACAAGTTGAGCGATGTTCTCATTTGTGGACAAAATACGCTTCGCAGTTGCCATGGGGACGAGGAACGCGTCCGAGTCAGGTGTCGTC
ATAGGCTCGTTTAAAACGATATTCCGCAGAGTAAACAAAGCTCTCTCTCCAACTTTTCCTGCATCAACAGGCTCAGCTACTAGCTCCATCCACCGCAATT
CTGGTGCTTGAACGAGTTTTTTCCACTCATGTTCAAATGAATCATGCTTCTCGTGTACAGAGCAACAACACACTAAAACATGCTTCAGCATACTTATGCG
TGAGCGGAGATGCTGGTACACTTCAACTGGTGAGCATGGTCCGATTGCATACTCGTCCGGGTCATCGGTtGTTTTGAGCcTCCACCGCAGTTTCAGCCTC
ACGTCACCACATGACAGGTTCGTCAATGGAATCGATGAGACACTCTCTTGCTCAGGAACGGCGTCAAGACCAATTATTGGGTACTCCTCGCCGTCATCGC
TCAAACTGGCCTGAAGAAGACTTCGTGATGCCACCCcACGACGATGACACAAAaCAGCCATAAAGAGTACAGCCGTAATGAAGTGGTCAGTAGAGAGATG
TCGTGTAGTTATTGGACTGTTGCTCAGGTTTGAAACCAGCTCGATGAGGTCAACAATCTCTCGGTTGTCAAAGGATTTGAGCACTGTTTCCATCAGAAAC
TGCACTCGATATGCAGGACTAGAGCGCACGAGTGGAAAGGCCCTTGCAACTTCAATAAGTGTCTTCACCAGAAGGTCTTCATCGCTGGCGGGTGATTGAG
CAATAAGCTCAGACATCCGGAGCTGGAGCATACCGCTGCTGGCGACGTGTGAACTCTCTGTAGTCTTCGCCATGAATCGAACTTCCAGCCATCTCTGGTA
TACCTCATTGTAAAATGTGACAGGATCCTTGGCGATCTCGCCTGCAGAGAAGAACGTTtCGCCTGACTCGCCTGCTCCCAAGTCAAACAAAtGATTTTTA
TCACTTCCACCACTGaGATGATTCCACTGTTTGGCGACCCTTTCGAGGTCGAGCGACCCATCGTGGTGTTTGGCAATAaGAACACGAAGGAAGAtGTTTt
GCACGACTATCTCGTCTCCGATCGATGCATATCTAACCTCAAaCTGTTGGTGATTCcAAaCCAGCCTTCCACAATTGTCTGCCACACGTCCAGCACCGTC
GTCGATGAGATCAATTGCGCGTTCCATCGCACTTTTTAGCTCTTCGCGCATTCTCCCATTCCACAACAAATCGGGTTGAAAGAAGTCACGATAGAGAAGG
TAAACCAAAACCGACACATCCTCGCCGGTCTCTCCTTCATAGTTTGAGCGAGATCCGTCACCAGTTACTCGGGCCGCTTTGATCGAAGCATTACCAGGAA
AACTTGAAGATATCTCCTGACGCATTCTACGAaTAAACCACTCAGAAGCATTGAAGTCTCGGTGTTTCCGGTTCTTCCCTTCCTTCACTTTAGTTTGTTC
ACGCTGAGCCATCATCAATTTCTTTGCAGCTGGAGAGCTGAGAATCCGCACTATTCCGTGTGGAAGCATTCTTTGAAGCAGCTCAAAaGaTTGCTTGTGA
TGCACGATCCACATTCCCGTGATGTACTGGAAAGTGGCCcGCCCTGCCTCTGATGGAAAGAAAATCGCATTGTACAGGCTGCGGAGCGTTAGTCCACTTT
CCAGAGCGGAGTCACACATTCGTTTGTGTGTCTTGACATCGGTGTTTTCCAAAGTCACTTTCAAAAGGCCAGTGGCAAATACTGCGAGCCcAATAACGGT
CTGGTGGACTGCCATGAGCTGAAGCACGGACGAGTTGGCACTCAAGTTCTTGATGATACAGTCATAGTCGTTATTATCAGTGCTGGACCGACTTCTTATA
ACGCAGTCATAGACAAGCTCAAGTAGACCCAACGCGCAAAGTGGTTGATGTTCTCGCTTCAATATGCTGAACAACACATCCATGACTCTTTCACGTCCAA
ATACAAGGGCTCTCACTTGTTTCTCAGCATGCTTCTGACTTGGTGCGCGTCGCGAATCCACACACAATGAATGAATAGCCTTTAGGCCCCAGAAAGTGCT
AATTGGATTGTTTGCTTCGATGATCAGCAAAATGCGGTCAACAAACTCAGCGATGCGCTCATGTGGTTCATCACTTGCGAGACGATAGCAACCGCTATTG
ATTTTGAAGAAGGCTTCAAGCACAGTTGCAATCTCTGTGTGGCGCATGGGGTGCTTCGACGTATGCAAGAGCTGCATTAAACGAAGACTAAGTAGCATGT
ATAAACCAGGGTAAACAAAGAGATACTCACCACAGTGGATAGTCCTTGGAAGATCGATCGGAAGCTCAACTGAGCGAGGCGCGCATCGACGGAGGGTGAT
GTAAAATCTTCTGGTTCAACGTTCATGTTAAGATTCTCCAAAGCGAAGATAACTTTGTCCACGGCGTTGACTGAAACAGACCCCGACGAGTCGGTCGTGA
GTCGCTCGAATTCCTTCGCTAGTACGCGATGGGCAGCAATAAACATGCCCTCCTTCGTGAGATAGGCAGTTTTTTCCTCGTCTTCGCTGAGTAGTCGTCG
AGCGGTCAAACGAGGATTAACATGAGAGAACTCAGGTGCAATAGTGAGGGACACGTTCTCGCAGAACAGACATCCATCGTACAGCTTTGCCAGTATACCA
ACTGGATCACTCGTGAGATAAGCAACCCGAGTACCATCTATGAAATCAATCCCAAGCATCGATCTCAAGTCGCCGTGCTCAACGTGAGGACTTGGTACAC
AAGAAACTCGGCGCAGATCTTTCAGGGAGTAAGATTTGACTTTTGGTTTCTCTGGATCTCCTTCAAACATCATTCCGTTTACCACAAGAATTTGCTTCTT
GCTGAACTTAAaGAATCCGTGTCGCCCACGCCGCTTCACGACATCAGTGGCACCACTTCCACTTTGTCCCCATTTGATGACATCGGGCCGGCGAACATCA
GATCCACGCTGGTCCGGCTTGGGCAGCTGTTGAACTGACTCAAAGTTCAAGCGAATACCGATGACACCTGAGAACTCGCGCATTATCTCcACGATCTTCG
ATCGGGAATCTGAGTACACGTAAAGAAATTTGtCCcTTACTGTCAGAGCGAACGCcTCGGGGTTATCAACAGGGAGGAATGCACGCTGAATTGATCGAAA
CTCGATCTCTTGTGTCGAGCGATTGACGACACGCACTACTGTCAGACCTCTTGGAGTCAAGCATAGTTCACTCTTCTCACGTTGTCCGTTTGGCTTGCCC
AGAAACCCGCTGAACTGGAAgCACTTGACAGCGAAATTGCGCTTAAAATCATCAAAGCTTCCAGTTAAGTGACTCATCAGTTCCTGCAGGAACACGTTTC
GACAGCGGTATCTGAGGCGCAAGTACATCGAGTCGTTGTAGTGGTTCATTGGCTGCTTCTTCGGTCCACATACTGCTTCAATGAAGAGGCGGTATTGCCT
GAGAAGAATCTCGGGGTTCTGCACTGCGATACCGGTCTCACTTGGTCCACTCTTCACCGAGCTGGGCCCTGAAGGTGGGAAACGAGAGGACCAGTTGTGT
CCCATCCTCACAGAGACAACTCTACGAGACGATCTAGCGCTCGTGTATCGACCAAGGTTGACGTCATACGTAAGGTGTTCACCAAATCCCATGGATTGAG
GAGGCGGGTGCACCGCATTCGCTAAAAGTGAAGCAGATGAGGACACAGATGCTTCGATCCcTCcTTCGTCCAAATATCCTGACGACGGATTGTTAGTCAT
ACGcGCCAAGATGCCAACGCAAGCTTCCACAGTAGCAAGACATGGgAAGCCGAACAAAATGCGATGAAGCATCTTGAAACGGCGACCGAGCTGCTCATGC
AACGTCTTGGACAATTCAAGCTGGCGTTCAGGGTGTGTCTTTAAGAGACACAGCAAGAACTGACAAAGCTTCATCGTCGGCAAATCACTGAGGTACTGCT
GGGTCTTCGGGTCGAGATCCAGCAACGAAAGCATCGTCGAGAGGAAAGAGTTGTTGGCCAAGAGAATAGCTCGGCACTGGATGCGGTGAGGCTTCGACTC
AATCAGACGGAGCAAGACCATAAACACCCAGTAGACAGCCAGTGAGCTCCTACCAATCAGGATCTCGGTGAGTGTGAGCAAGTAGTCATCCCCCCGcTAC
ATAAGAAAGAGTGAGTTAGTGAAGAAATCCGTCGAGACAAAGTaGTCAGACTCACCTCAAGCAAAATGTTAACAAACTCCCTcATAGCCGGTGGGGCGTG
AAGTAAGCGGTACAGGGTCTGGAGATAAGTAGACAAGTACGGATGGCGTGGTCCATGTCGACTAACAATGTCACGGATTTCGCGGGCTACAACATACGCA
GCCTTGTCAAATGGCTTGTTCGGTTGAGCAATGACGCCTGAGGTTGGGGTGTTCGCGTTGAACTCTAAAGCCAGTGAGTACATCCCTTCGTCGATTCCCA
TAGGCAACTGACGCTGGATTCGAGAAGTTTTGCTTGCTCCATGAGTTACCAATTGCTGAAGAATGCTTGATTGAACGATGCGTAACTCGCGATCCGATGC
TACAGTATCCTTGGTGACTACTATGATTCGGcTCCcTTCcATCTGGATGACCTTGCAGGGGACCATGCGTCGTGAGTCGTGAACTCGGTCTGCCATTACC
TCAACCTGGTAGCTCTTCAGAGCCTGGCACGATGTGATAATTTCTGACACAAGCTTTTCTCGATGAGGTGAGTAGAATGTGCGTCGAATACCGTCGACAA
ATACGATCTCAAACGCTTCCGTTGAATCCTCGAACAGGATGAGGGAAAAGATGCGTGAAAGCGGTCGACTACTGATCACAGTGTCACCGTcACCCAGCTC
TGCAATGAACCGCTCTGAGACTGCAAGTGTTCTGGGTGCAAGTGGTTTATTCGTCGACGATACACGCATCACTGGGTACTGGAAAGATATCTGGTCGATT
GCGGCACCGTGCTCGTCACCGCGGTTACATGCCGCCTCCATCGTCTTTTTGCGATACTCATTGATCTCCATTGCGTAAGCGCGCATCATTTGATGTATAG
CCTGCGCCATTTCGGTTCGCTTGTCGACAACAAACACACTGGAATTGTCTGAATGGTTCAGTACGATTGCTCGGCGATCATCACAAACGAGGTCGATTGA
TACGAGGCTGGTGTAAGGAATGTGAGACATCAATTCACCTTCCTCGTCACGCTGGTAGACACCGTCAGgCCGGATCTCGACCACGCATGGCGATTGTAGA
CCGCGCCTGTGGACTTTGAAGCATGAGAATGCAATCACCTGGAGCTCTGGACGCAGGCCTCTGCCTGGTGTCCGCGCTTGGAACTGACTTCGTAGACGCA
TCAAACTCACGAGCACTTCCATGCGATAATTGCATCGATACACTGTCTTCTTGATGCGATGACGCGGTGTAAGGATGACGAAGTCCGTCTCGCCTTCAAG
AGTCTTCGCGCCCTCGACTTCAGCGTATGACCACGTATTCGTCAGCATCTGCGAGTCTGGGTCATACGTCGAGAAATTCTTGTCGCCCAAACACATCACA
CGGTCCTtCACCACGAAGCTACCGACCTTCTGGACCATGAACCGAGCCACGTACTGCCGCGCGTCCATGGTAG