Description :
From Genome Similarity Track
Location :
Scaffold_154:24225- 26377
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_154-snap-gene-0.18DNA mismatch repair protein Msh3
Pytiw_DAOMBR242034maker-piw_contig_154-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
2152 bases(100 bases per row)
GTCAACCATGTTGAGTACCATGTTGAGTTCCAATATAAATACCCACTTTGAGCGTACTCACCGCTGTAATAAAGGCCGCGGGGAGAGTGAAGAGCCTTCT
TCGCCTCTTGTTGTAGCAGCAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTTGCTGAGCGCACGCATCGCCACGGTGTCAATCTGCTTCACGATGCCGACCTT
GTAGCCCGCGTCCACGAGCGTCCGGCAGTGGTGCAGCGTGCGGTGCACAGGCACAGAGGTCTGCCGAAAGTTTTTGTACTGGTGCACGCGGATGCCCAGC
AGCGCCGACGCAATCTATTCAACACACACACATACACGTTCACACACGCATTAAGTACAATTCAAAGGCGCATCTAAAGGAACGAGTCGCCAGGCACCAC
ACATGTAGATATAGATACGCACCTCTGCGTCGTCCGCGAAGATGCGCATGCGGTATCCGCACTCGAAGAGCAGGAGCAGGTCGCTGTGCTGCGCGCGGAT
CGCGACGACCTGCTTCTCCATCTCAGTCAGCGTCCTCATTGCTGCTGGTGCTAACGAGCCTGCTGTTGCACCACTGCGCTCTCGCTTGCGCACGCGCAAC
TTGTCGATCGCTCTGTACGCACTGCGCGTCTCTTTGTCGTCTGCATTCTCAGCAGCCGCACTGCGGGCGACGAAGTACGCGGAGAGCTGCTGCATATCGG
CTAGTGCTCGTCGCGCATTTCAATGTCGACTTCGTTAGGTTCGCACACACGTAAAGTACGCCCCAGTATTTTACTTGTGATTTCTTTAAAAGTTGTATAG
AAAGGCCACCAACTTGAGTAAATTCCCACTTCAACACGGCTCAACCGCCGCAACTTGACACTCAAGCGCAATCACAAGAAGAGCCACAATCAAGAAAGAC
ACGCATGGCTGCGCACACGACGCGCCCGAACCAACTGACGCGCCGAGTCAGCAGCTCCAGCCTTCCGCCAGCAGCAACAGCTCCATCAGCCCCGCAGGAA
CGCATGGGGACGAGCACACTCTCCAACGCCAGCGACGCGCCACCACAGCAACGCCTGTCGCGCATGTCGCGCTCCACGAAGAGCGCCGTGGCGCTCAACC
AGCTGCAGCATGTGGCCATCCCCTCCAGCTACACGCGCGCGCAGGACGGCGTGACCATGTACGTGCTGGACGTGGCGCTCAAACCCTACCAGACGGGGAT
CCCGAATGTCCGCAGGAGCGCCGAGTTCATCGACAGCCACTTTCTCAACCGCGAGACCAGCACTGCGAGTGTTGTCAGCAGCGCATCGCCACGGTCAATC
GCTCCGCAGCCACAGCCCAGTCAGAGCAACAACAGCAGCTGCCAGACAAACAAGGAGAAGCACGCGAGCGCAAGAGACAACAACAAATCGCAGCCGCACT
ATCAGATCGAGTACCGCTACTCGGCGTTCTGCGAGCTGCGCGCGCGCCTGCGCGACGCGGTGGAAGACAACGACCGCCACCACCTCAAGTGGTGCTGGTA
CTGCTCCAAGGTCCAGTGGGCGGCCACCTTTGGCGCGTTCCCGTCGCGCCATCCGTTGCTCAAGTCAATCGCAAGGCGCTCGCGCTGTGGCGAGAGCCTC
GAGCGCGTGCTGCTGGAAAGAGTGCTGCGTCGCCGGCAGCGACTCGCGCTCTTCGTGAACGACGTGATCGCGAGCGCCAAGGACGCGTCGTACAGGTACC
AGGCGGCGCAGTGCCAGTGCTACGCCAAGGTCGCAGCGATCGTCACCGACTTCCTCGCCGAGCCGCATTTAAGGAGTCTTGGTGGTGGTGGTGCGTAGTG
AGACTTGCGTGTGCGCAAATAGCAAATTGTTGTTGCGCAGGTTGTTGGATTGCTGTTCTTGTGGCAAACAACCAAGAGTTGTTGTTGCGTGAGCAACATA
TGCACAGAGACGAATTCTTGCGATTGCGCAGAAGGAAAGCACAACACGCAAG