Description :
From Genome Similarity Track
Location :
Scaffold_402:24221- 25380
Transcript NameFunction/comments
Phyta_totarag7963hypothetical protein

Sequence
1159 bases(100 bases per row)
TACCATTCAATTGCTCCAATGCTAGCATCAATGCTTGGGTTCCCAACCGGCCGTGTCCTTGTGCCTGAAAAACCCATAAAGCCGTTTACTTAACGAGATA
ACAGTGGTCAAATCTAGGATACAGAGACGCACCTTCACAGCAATGTATAATTGATGCGCTAGCGAAAGTCCAGGAAGCGATAGGTTCATCCTGCAGTAGC
AAAATGACATTTGCACGATTAACCTCCATCCAGCACTGGCAATCAAAGTGAAAACACGGCGTACCTCTCCGCTTCTTTAAGAGCGATGCCCATGTCCTTC
AGGAAATGCTCCACGAAGAAACCAGGGTCAAAATCTCGCTTAACGATGCGAGGGCCCATGTTACTGATAGACCACGAGCCAGCCGCGCCCGCGCTCACAG
CATGAATGGCTTCATCCATGTCCAGACCACTCTTCTTCGCGTACAGAAGGCTTTCAACCACTCCGATCATGTTGGTAGCAATCAATATCTGGTTCATCAT
TTTCGTGTGCTGACCTGCGCCGGCAGGTCCCATGTGGCGAATGCTCTTGCCCATTACGCTGAGAAAAGGCATCGTGACGTAGACAGGATCCATATCGCCA
CCAACCATGATGGATAGCGTTGCGTCACGCGCACCAACATCGCCTCCTGACACAGGCGCATCAAGAGTCGAAACACCCTTCAGCTTGGCCGCATCGTAGA
TCTTTTTTGACAACGCAGGTTCACTGGTCGTCATGTCTACAATGATGCCACCAGCCTTCATTCGTGAGAGCAAACCCGAGTCCGGGTCGAGCACTACCGA
CTTTACATCGCTCGGATATCCCACCATGATAAACACGATATCTGAAGTAAAGACATCAAAGTAAGATCAACGACGGTTAGAATAGCAGCGAACCACAACG
CAGCATCAATGTTACGAACCAGAGTTCTGGGCGACTTCAGCAGGTGAACCAGCCACTCTTGCCCCCTTTTCCCGTAGCCCGTCGCACTTCGAAAGCGTTC
GGTTATACACAGTGACTTCGTAGCCGTGGTTCTTTGGGAAACGACAGAAAGTAAGCACAAGTTAACATCAAGGCCTCACCAGAATAATTCATTATCAAAT
CGTACCATCAAATGCCCGCACATGCTAGCACCCATGATACCCGTTCCGATCCAGCCCAC