Description :
From Genome Similarity Track
Location :
Scaffold_1280:2422- 5691
Sequence
3269 bases(100 bases per row)
GATCCCAGCCGTGAACCAAGTAAAACGGTGTGTCTAAACGAATAGCGTCGAAGGGTGTGTTCAGAGCCCACATCAACTTCTCCACTTGGTCGTCCCAGTC
GCTCTGGTCTGGTTCTGAGACGTAAGCTCGGATAGCTCGGACTACAGTCTGCACGGACCTTTCCTGTTGGCCATTGGCCTGAGGTCGGTATGCCTACGTT
GCTCGCTGTTGACTGTCCAACATCTCTCGGAACTTAGTGAACACATCACTGTTGAAACGTGGATCCCTGGGATGACGAAGCACAACGCTAGCCCCAAACC
TCTGGACCACACATTCCATGTAAGCTTCAGCAACTTCCTGAGCTGTGGTAACACTCACCGGTCGACAAATCACAAACCCCGAGAGTAAACATTGGAACAA
TAGCAGGAACACATTGCCACCGTCAAACATTGGCAGATGTGTAACGAAATCCATGGATACCACCTCAAAAGGCCTGATCGCCAGAATAGTGCCTGGTGAT
GGCCCGGGGTTTGGCGATACTCCTTTGGCTGTGACACAATCCACACATTCCTTGACGCGATGTTCCACATCAGCGTACAGTCTAGGCCAATAGTACTCTT
GGCGTAATCGCTCAAAAGTCCGAGTTATCCCTTGATGTCCACCTTGAAAGACTTCGTGGCTCAGTTGTAGGAAATCCTGCCGGAGCGCGGTTGCGACTAC
AAATCTCAGATTACCAGCCGTATCCCGAGGTTGGCTCGGTGTGGGTCGACTCAGATAGTACAGCACTCCACGAGAGTCGAGCGCAAACTGGTCGGCCACT
TTAGCCAtctcttcagcttcgacagACGACAACTTCGCCAGGTCCCCTTTCAGATAAGCACTCACGTTTCTTGTCCAgagctcagcttcttggtgggcCA
GAATATGCTACCAGCGTTCAGTTGTCGATGCAGCCGATGTGGCGTCTCCAGCGGAATACGTCTCCAATATCGGTACAGCTGTCTCTTCGACCGAGTGGTT
TCTAGCTTCGGATACCTTGGCACCTACGTCGTTGGTGGCAATTGTTCCTGCGACACGGGCTTGATTCTGTGTAACCACAAATAGCTAAGCCGTCGGTCCA
TGGGTTCAGCTGCCTCTTCAACCCACATTTGCTCTGCCATTACTCGCTTGGCTTCCGGATCTGAACTTGGTCTAACTCCCAGCTCCAGCGGTTTGGTCTC
AACCATCTTATCCAGCTTTTCAGGAATGAGgttcagctgcttgagctgagCGAACTGCACAGGATCATCAACAACTAAAGGGTGACGAGCTTCCAAAGTC
TTGGTTGTGATATAATCAGCCTCCGCATTAAATTCACGTTTGACATGAACCAACTTCAGAGACCGGAACTTTTGACGAAGCAACTCAAACTCGCCGAGCA
ACAGCTGGAGTCCAGGCTTCAAACCCTGGATCAGACCCTGAGCTTGCTGAATAGCGATCCTAGAATCACCGATCAGCACCAAATATGAGACCCACACGAG
TCCCTTAAATCAGGCCATGATACTCAGCTTCATTCACCGTGATATCTTCGAAATGAAAACCACGCGCTTCGACTACTTCCCAAGACGGGAGCTTCCACAA
AATACAGCCGGAGCTACCACGTCGATCAGAAAGTTTAGCTGCTCCACCGAAACTGAGCAACCAGCCTTCGTAATCCGCCTCGAGCATCTCCAGACTTATT
GGTGGTGCTCGAACAACGCATCCCTTGGTTGGGGTAAGATTCTCAGCGATCTTGTCTAGCTGGTCTCGGGGAGTGATACCAGCTCCCATGATTGCGGCCG
GCCATCCTCATCGGACTTGATCTTGTGAACTTCCAAAGGCCAATGGGCCAATCGAGCAGCCCACTATTCGGAACGTCCTTCCAAAGACCGAGACCGGAAA
ATCCACTTCTGCACCGAATATCGCGTATAtaccttgagcagcttgctTTCGGTCAACATGGTATAGAAGACTCTGAGAAGCCGGAGTAAGGCGACAATCT
CCTTTTCAGCCGGATGATATCGGAGTTCTTGGCCATGGAGCACTCTCCCAGTAAAGCGAACAGGAAGGATAATTCCATCGTATTCTTGGTCCAGCACTGC
ACTGACAGCTCAGGGATTCGCGTGAACAATGATCACAATTGGTTTTTCCCTGACTGGGTGTCTGAGGAGTGGTGTAGAAACGATCTTCCGCTTCAGAATC
CCAAATGCTTCCTTGGCTCAGCTCAGGTCTCGACCAGCCcggatctgctcgtccgtcagcagctcgtacaggACAGAAGCTACAATTGGGAGGTATTCGA
TGAACTTATTGTAATAGTTCAAACTTCCCAGAAATGACTCGACGCCTTTCAAAGTCGACGAAAACGGGAGAGCTTGTACGCCCTTAGCGATCTTTGGGTT
AGCACGGATCCCCTCAGTCCCAATTTCATGAGACATGTATGAGATCATCTTCTTGTCAAATTCGCTCTTGGGCAAACTCACAGAAATCCCCCAGTACCTT
TACCGATCCAACAACCGATCGAGGTCGACGCATAGCTGCTCCCAGGTGTCAACTCTATACGCGATATCAGCAATGTAGGAACTTCGTCCCAGAACTGGGT
TTAACTCGGGTGGAGCTGGAATGTTCCTTCGGAAAACAATCATTCCCTTAGACAGTACTCGCATTTGGCTTTCCTTAACCGGAGGATCGACTTCAATCCC
TAGGAATTCCAAGACATCTGGACCCACccgagcttcttcaccggGTGGGAGCCGAACGACACCCCAGAGACAATTGTCAAGCATTTGCTGGTAATGCGCA
GCGCATTCTTCAGTCCAAATGACATTCGCTTCCACTGAAAGCGATCTAGCGGGCGAATGAAAGCTGATATGTGCTTCGCTCGGGGAGGCATCGGCACAGC
CCAGAACCCACTCTCCATGTCCAAACTGAGAAACCACATTGCATTCTCAAACCTAATCAACAGATCGTCGATCAAAGGTAGAGGATAGTGCATAAGCTTG
ATTAGCTGATCCACCAGTCGGTAGTCGATGCACAGCCGAATGTCGACGCAATTATTCTTCATCACGATAACGATCGGGGATGCCAAACCTGAGTCAGAGT
ACTCGATGAGCCCCGTCTCCAGAATTTTTTGAGCAATTCGTACACCTTGCTGAGATGGTGTGGAGGTATAGGCCTGGATTTCTGGGCAATTCGCTGAGCC
TCGCCTACATCCAAGTCACAGACCACACCCCAAGCTGGGGCTGGAACCGCATTCCCATCACCCAGAAAA