Description :
From Genome Similarity Track
Location :
Scaffold_1270:2422- 3638
Transcript NameFunction/comments
Phyag_g10121pectate lyase

Sequence
1216 bases(100 bases per row)
CACCTTACTCGAGCTCCCCCACTCCAAAGTTGCTCGTTGACAGCGTCAAGTGGTGGGCTTCCTTGGGGGTGTAGCGACCGATCGTCgggtgcgtcttcat
cgctgccagAGCAGTGGAGCCGTTGCGGCTTCCAAAGGGTCCGCTGTCCTCCAACACGTTCGCCTCGCACAGTCGACCCAACTGAGCGGTGCACTCGTCT
TCAGACGACTCGAGCGGCGCGTAAATGGATCCGTCAGTCATCCCAGGGACATCcgagtcgtctccgtcgtaCAGCGGCTTGGTCGTGTTCACAAAGTAGT
TCCCTTCAGCGAGCACGTAGGCGTTAGTGCCAATCTCCATCGAGTGGTAGGAATTGTCCTTGTaaagttgttggcgatgtgCGTAACAACGTTGGTATCG
GGAGTACCGCCAACTTTTGGGAGACGACCCGACAGGTAGTGGATGTAGTTGTTGACCATGCTGATCCCCGTGTGTCTTCCGTAGAGCAGGAAGCTCCAGT
AGTCGTGACCATCACAGGTCTTCGAGAATTCAGTCCTGCCGTTGAAATCCGAATTGCTCACGGTCAAACTGGAGACACCGGCCTTATCGACGGCCAGGAA
CTGCCGTCCGATGCGCGAGATCTTGATGTGGTCGAGCCAAATGTGCTTCAGGGGCACCGTTCCGTCGGTGAGACCCTGAGCGGTGATAGCGTCGCCACCC
CACACGAGGTGCGGGTTGATTTCGGTGATGTGGATATTCTGCACGatgatgttgtcgctgttgagATTCAAGCCCTTGCCCATGATCACTCCGCTCTGGC
CGACGCCACGGATGGTTTTGTTGCCTCTGACATTAATTCGGTTGAGACCCGCGTTGTCGTAGGGTACTGTGACTTTCGTGCCGTTGGTGCATCCGCCGGT
GTTGCTCATGCCGCCGTCCTGGAGGATCACGTCTTGACTCTTGAAGCCGTTGTTGAGCGCCATGCATCTGCGCGTGTAGTCCGGACGACAGCCGTCGGCG
GTTGTGTTCCCCTCCAACTTACGGAAGTCAAATGTCGTGTTCAAGACTACCACACGCGGTACTGGGTCTCTCAAGAACGCAACGAGCtctttggtggtgg
tcggGTAGACTGCAGGAGTGTCACCGCCGCCAGTAGTTCCCGTTGCCAACCCGACGGGGGATCCGATCGTGATGGCGGCAGGCGTTGAGCGACCCACCAA
CGCCACGGCTGCGACG